Dimerization and a Novel Tax Speckled Structure Localization Signal Are Required for Tax Nuclear Localization

Abstract

The human T-cell leukemia virus type 1 oncoprotein Tax has pleiotropic activities, a subset of which likely leads to immortalization of T cells. Tax is expressed and known to function in both the cell nucleus and the cytoplasm. Tax has defined nuclear localization (NLS) and nuclear export signals that enable shuttling between the two compartments. In this study, we identified a novel region in Tax that targets the protein to discrete nuclear foci that we have previously termed Tax speckled structures (TSS). We demonstrated that the identified region is both necessary and sufficient for directing proteins to TSS. This novel TSS localization signal (TSLS), spanning amino acids 50 to 75, is separable from and adjacent to the NLS of Tax. Coexpression of a Tax NLS mutant and a Tax TSLS mutant rescued the nuclear entry and subnuclear TSS targeting of both proteins, demonstrating that these signals are independent domains. Our analysis also revealed that Tax proteins deficient for dimerization fail to localize to the nucleus. Consequently, when we restored dimerization via induction of a heterologous "dimerizer" domain, nuclear localization was rescued. Thus, we defined additional domains in Tax specific for nuclear localization and subnuclear targeting. Our results reveal a more complex network for regulation of Tax subcellular localization and subsequent function.Human T-cell leukemia virus type 1 (HTLV-1) is the etiologic agent of adult T-cell leukemia as well as subneoplastic disease states, the most prevalent being HTLV-1-associated myelopathy/tropical spastic paraparesis (22,44,47,63,68). Tax is a potent transcriptional transactivator of both viral and cellular genes and can physically associate with a number of cellular proteins, thus altering their functions (10). Expression of Tax results in the dysregulation of critical cell functions, including cell cycle regulation, proliferation, DNA damage recognition and repair, and apoptosis. Furthermore, although the pathogenesis of adult T-cell leukemia is not completely understood, the transformation of T cells infected with HTLV-1 can be logically attributed to genomic instability resulting from the pleiotropic activities of the viral protein Tax (30, 41).Of particular note for this study, Tax has documented nuclear and cytoplasmic functions; thus, the regulation of Tax localization to subcellular compartments is a critical aspect of overall Tax function (11, 23, 52). Tax contains a nuclear localization signal (NLS) sequence in the N-terminal region of the protein that is necessary and sufficient for nuclear localization (23,53,55). We previously showed that Tax "shuttles" between nuclear and cytoplasmic subcellular compartments and identified a consensus nuclear export signal (NES) sequence defined by amino acids 190 to 203 (11). Subsequently, a fine-mapping mutational analysis of this region by Alefantis et al. (1) clearly demonstrated a functional NES at this site. These signals presumably mediate interactions between Tax and karyopherins in the nuclear pore comp...

Interaction of HTLV-1 Tax with minichromosome maintenance proteins accelerates the replication timing program

“…Importantly, this 2 to 22 deletion does not affect the zinc finger motif of Tax, required for its nuclear localization. 20,21 Tax was able to associate with endogenous members of the MCM2-7 complex but failed to bind other replication regulators, such as MCM10 or HBO1 ( Figure 1B; and data not shown). The physiologic relevance of the interaction between Tax and endogenous MCM3 was further validated in HTLV-1-infected cell lines ( Figure 1C).…”

The Sumo-targeted ubiquitin ligase RNF4 regulates the localization and function of the HTLV-1 oncoprotein Tax

“…Specific sequences within Tax that serve to signal nuclear localization, 6 nuclear export, 5,8 specific targeting to TSS's, 7 and cellular secretory activity have been identified. 42 It is also clear that posttranslational modification of Tax provides a rapid way to regulate subcellular localization, possibly via modification of the presentation of these defined localization signals.…”

“…The Tax protein contains a nuclear localization signal, 6 and we recently identified a specific signal sequence that targets Tax to nuclear bodies. 7 We and others have described a nuclear export signal. 5,8 In addition, Lamsoul et al showed that ubiquitylation of Tax is correlated with its accumulation in the cytoplasm, whereas sumoylation of Tax is required for nuclear localization.…”

“…7,20 Tax double-point mutant S-TaxK280/284R-GFP was created using site-directed mutagenesis of S-TaxGFP with the QuickChange kit (Stratagene) and primers TCCTCCTTTATATTTCACAGATTTCAA and GGGGTGGTAGGCCCTGGTTTGAAA. RNF4-GFP and RNF4-mCherry were purchased from Genecopoeia.…”

The MHC-II transactivator CIITA, a restriction factor against oncogenic HTLV-1 and HTLV-2 retroviruses: similarities and differences in the inhibition of Tax-1 and Tax-2 viral transactivators

“…Many studies have shown that sumoylation, ubiquitination, acetylation, and phosphorylation play a critical role in the subcellular localization, protein–protein interaction and function of both Tax-1 and Tax-2, revealing similarities and differences between the two transactivators (Bex et al, 1999; Chiari et al, 2004; Lamsoul et al, 2005; Durkin et al, 2006; Nasr et al, 2006; Gatza et al, 2007; Lodewick et al, 2009; Turci et al, 2009; Bidoia et al, 2010; Bertazzoni et al, 2011; Journo et al, 2013). In addition, dimerization of Tax-1 is necessary for its nuclear localization and interaction with CREB and the 21-bp repeat elements (Tie et al, 1996; Jin and Jeang, 1997; Basbous et al, 2003; Fryrear et al, 2009). Similarly, we previously described that CIITA expressed in cells, but not CIITA produced in vitro , forms homodimers in a phosphorylation-dependent manner (Tosi et al, 2002) and this modification is a prerequisite to CIITA nuclear retention (Tosi et al, 2011).…”