Differential targeting of cPKC and nPKC decodes and regulates Ca2+ and lipid signalling

Hui, Xin; Kaestner, Lars; Lipp, Peter

doi:10.1042/bst20140239

Cited by 6 publications

(1 citation statement)

References 57 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The wild-type human PKCα protein was fused with eGFP, eYFP or, DsRed2 at the C-terminus in the pCDNA3 plasmid as described previously 7, 38 . The full-length of human PKCα N-terminally fused to eYFP was constructed into the plasmid pEYFP-C by PCR with following primers, 5′ GCCTCGAGTGGCTGACGTTTTCCCGGGC and 5′ GCAGATCT TTATACTGCACTCTGTAAGATGG.…”

Section: Methodsmentioning

confidence: 99%

PKCα diffusion and translocation are independent of an intact cytoskeleton

Hui

Sauer

Kaestner

et al. 2017

Sci Rep

Self Cite

View full text Add to dashboard Cite

Translocation of cytosolic cPKC to the plasma membrane is a key event in their activation process but its exact nature is still unclear with particular dispute whether sole diffusion or additional active transport along the cell’s cytoskeleton contributes to cPKC’s dynamics. This was addressed by analyzing the recruitment behavior of PKCα while manipulating the cytoskeleton. Photolytic Ca2+ uncaging allowed us to quantify the kinetics of PKCα redistribution to the plasma membrane when fused to monomeric, dimeric and tetrameric fluorescence proteins. Results indicated that translocation kinetics were modulated by the state of oligomerization as expected for varying Stokes’ radii of the participating proteins. Following depolymerization of the microtubules and the actin filaments we found that Ca2+ induced membrane accumulation of PKCα was independent of the filamentous state of the cytoskeleton. Fusion of PKCα to the photo-convertible fluorescent protein Dendra2 enabled the investigation of PKCα-cytoskeleton interactions under resting conditions. Redistribution following spatially restricted photoconversion showed that the mobility of the fusion protein was independent of the state of the cytoskeleton. Our data demonstrated that in living cells neither actin filaments nor microtubules contribute to PKCα’s cytosolic mobility or Ca2+-induced translocation to the plasma membrane. Instead translocation is a solely diffusion-driven process.

show abstract

Section: Methodsmentioning

confidence: 99%