Differential requirements for cyclase-associated protein (CAP) in actin-dependent processes of Toxoplasma gondii

Hunt, Alex; Russell, Mark; Wagener, Jeanette; Kent, Robyn S; Carmeille, Romain; Peddie, Christopher J.; Collinson, Lucy; Heaslip, Aoife T.; Ward, Gary E.; Treeck, Moritz

doi:10.7554/elife.50598

Cited by 54 publications

(66 citation statements)

References 71 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…TgStx6 was previously shown to localize to the trans-Golgi apparatus ( 54 ) and was detected by coimmunoprecipitation with TgVps45 by mass spectrometry ( Table S1 ). To determine if such a complex might be also formed and fulfil similar functions in apicomplexans, we engineered the endogenous locus of TgStx6 using the LoxP/U1 RNA destabilization strategy in a DiCre-expressing strain ( 55 – 57 ). Correct integration, replacement of the 3′ untranscribed region (UTR), and rapamycin-induced DiCre-mediated excision of TgStx6 were analyzed by PCR ( Fig.…”

Section: Resultsmentioning

confidence: 99%

The ZIP Code of Vesicle Trafficking in Apicomplexa: SEC1/Munc18 and SNARE Proteins

Bisio

Chaabene

Sabitzki

et al. 2020

mBio

View full text Add to dashboard Cite

Apicomplexans are obligate intracellular parasites harboring three sets of unique secretory organelles termed micronemes, rhoptries, and dense granules that are dedicated to the establishment of infection in the host cell. Apicomplexans rely on the endolysosomal system to generate the secretory organelles and to ingest and digest host cell proteins. These parasites also possess a metabolically relevant secondary endosymbiotic organelle, the apicoplast, which relies on vesicular trafficking for correct incorporation of nuclear-encoded proteins into the organelle. Here, we demonstrate that the trafficking and destination of vesicles to the unique and specialized parasite compartments depend on SNARE proteins that interact with tethering factors. Specifically, all secreted proteins depend on the function of SLY1 at the Golgi. In addition to a critical role in trafficking of endocytosed host proteins, TgVps45 is implicated in the biogenesis of the inner membrane complex (alveoli) in both Toxoplasma gondii and Plasmodium falciparum, likely acting in a coordinated manner with Stx16 and Stx6. Finally, Stx12 localizes to the endosomal-like compartment and is involved in the trafficking of proteins to the apical secretory organelles rhoptries and micronemes as well as to the apicoplast. IMPORTANCE The phylum of Apicomplexa groups medically relevant parasites such as those responsible for malaria and toxoplasmosis. As members of the Alveolata superphylum, these protozoans possess specialized organelles in addition to those found in all members of the eukaryotic kingdom. Vesicular trafficking is the major route of communication between membranous organelles. Neither the molecular mechanism that allows communication between organelles nor the vesicular fusion events that underlie it are completely understood in Apicomplexa. Here, we assessed the function of SEC1/Munc18 and SNARE proteins to identify factors involved in the trafficking of vesicles between these various organelles. We show that SEC1/Munc18 in interaction with SNARE proteins allows targeting of vesicles to the inner membrane complex, prerhoptries, micronemes, apicoplast, and vacuolar compartment from the endoplasmic reticulum, Golgi apparatus, or endosomal-like compartment. These data provide an exciting look at the “ZIP code” of vesicular trafficking in apicomplexans, essential for precise organelle biogenesis, homeostasis, and inheritance.

show abstract

Section: Resultsmentioning

confidence: 99%

The ZIP Code of Vesicle Trafficking in Apicomplexa: SEC1/Munc18 and SNARE Proteins

Bisio

Chaabene

Sabitzki

et al. 2020

mBio

View full text Add to dashboard Cite

show abstract

“…In Toxoplasma gondii, the IMC "apical cap" comprises the anterior-most ~1 μm of the IMC, just basal to the apical complex. The apical cap appears to be a site at which actin regulators (13) and subcomponents of the parasite invasion machinery concentrate (14). While a number of IMC proteins have been genetically manipulated and evaluated phenotypically, their biochemical functions have been understudied.…”

Section: Introductionmentioning

confidence: 99%

Ancient MAPK ERK7 is regulated by an unusual inhibitory scaffold required for Toxoplasma apical complex biogenesis

Back

O’Shaughnessy

Moon

et al. 2020

Preprint

View full text Add to dashboard Cite

Apicomplexan parasites use a specialized cilium structure called the apical complex to organize their secretory organelles and invasion machinery. The apical complex is integrally associated with both the parasite plasma membrane and an intermediate filament cytoskeleton called the inner membrane complex (IMC). While the apical complex is essential to the parasitic lifestyle, little is known about the regulation of apical complex biogenesis. Here, we identify AC9 (apical cap protein 9), a largely intrinsically disordered component of the Toxoplasma gondii IMC, as essential for apical complex development, and therefore for host cell invasion and egress. Parasites lacking AC9 fail to successfully assemble the tubulin-rich core of their apical complex, called the conoid. We use proximity biotinylation to identify the AC9 interaction network, which includes the kinase ERK7. Like AC9, ERK7 is required for apical complex biogenesis. We demonstrate that AC9 directly binds ERK7 through a conserved C-terminal motif and that this interaction is essential for ERK7 localization and function at the apical cap. The crystal structure of the ERK7:AC9 complex reveals that AC9 is not only a scaffold, but also inhibits ERK7 through an unusual set of contacts that displaces nucleotide from the kinase active site. ERK7 is an ancient and auto-activating member of the mitogen-activated kinase family and we have identified its first regulator in any organism. We propose that AC9 dually regulates ERK7 by scaffolding and concentrating it at its site of action while maintaining it in an "off" state until the specific binding of a true substrate. Significance StatementApicomplexan parasites include the organisms that cause widespread and devastating human diseases such as malaria, cryptosporidiosis, and toxoplasmosis. These parasites are named for a structure, called the "apical complex," that organizes their invasion and secretory machinery. We found that two proteins, apical cap protein 9 (AC9) and an enzyme called ERK7 work together to facilitate apical complex assembly. Intriguingly, ERK7 is an ancient molecule that is found throughout Eukaryota, though its regulation and function are poorly understood. AC9 is a scaffold that 2 concentrates ERK7 at the base of the developing apical complex. In addition, AC9 binding likely confers substrate selectivity upon ERK7. This simple competitive regulatory model may be a powerful but largely overlooked mechanism throughout biology.

show abstract

“…DegP2 cKD parasites were constructed by transfecting DiCre parasites 117 , with pU6-Universal carrying the gRNA GCGCTCACAAGACCTCGCTGG (P9 and P10) along with a repair template encoding an HA tag followed by the T. gondii CDPK3 3′-UTR flanked by two loxP sites, and followed by four U1 recognition sites and a DHFR resistance cassette. This repair template was PCR amplified from a custom-built plasmid using the primers P46 and P47.…”

Section: Methodsmentioning

confidence: 99%

“…DiCre/tdTomato parasites were constructed by integrating a tdTomato expression cassette into an intergenic region at position 1487300 on chromosome VI. DiCre parasites 119 were co-transfected with a Cas9-expressing plasmid carrying a gRNA with the sequence GCCGTTCTGTCTCACGATGC 46 and a repair template encoding a TUB1 promotor, tdTomato coding sequence, and the DHFR 3′-UTR, which was amplified from a custom-built plasmid using the primers P44 and P45. tdTomato-positive parasites were selected by FACS, and a clonal population was isolated using limiting dilution and confirmed by flow cytometry.…”

Section: Methodsmentioning

confidence: 99%

Genetic screens reveal a central role for heme metabolism in artemisinin susceptibility

et al. 2020

View full text Add to dashboard Cite

Artemisinins have revolutionized the treatment of Plasmodium falciparum malaria; however, resistance threatens to undermine global control efforts. To broadly explore artemisinin susceptibility in apicomplexan parasites, we employ genome-scale CRISPR screens recently developed for Toxoplasma gondii to discover sensitizing and desensitizing mutations. Using a sublethal concentration of dihydroartemisinin (DHA), we uncover the putative transporter Tmem14c whose disruption increases DHA susceptibility. Screens performed under high doses of DHA provide evidence that mitochondrial metabolism can modulate resistance. We show that disrupting a top candidate from the screens, the mitochondrial protease DegP2, lowers porphyrin levels and decreases DHA susceptibility, without significantly altering parasite fitness in culture. Deleting the homologous gene in P. falciparum, PfDegP, similarly lowers heme levels and DHA susceptibility. These results expose the vulnerability of heme metabolism to genetic perturbations that can lead to increased survival in the presence of DHA.

show abstract

Differential requirements for cyclase-associated protein (CAP) in actin-dependent processes of Toxoplasma gondii

Cited by 54 publications

References 71 publications

The ZIP Code of Vesicle Trafficking in Apicomplexa: SEC1/Munc18 and SNARE Proteins

The ZIP Code of Vesicle Trafficking in Apicomplexa: SEC1/Munc18 and SNARE Proteins

Ancient MAPK ERK7 is regulated by an unusual inhibitory scaffold required for Toxoplasma apical complex biogenesis

Genetic screens reveal a central role for heme metabolism in artemisinin susceptibility

Contact Info

Product

Resources

About