Differential kinetics for induction of interleukin-6 mRNA expression in murine peritoneal macrophages: Evidence for calcium-dependent and independent-signalling pathways

Abstract

It is presently unclear what role elevations in intracellular calcium concentration ([Ca2+]i) play in the control of monokine secretion, or whether such alterations underlie the ability of physiologic stimuli to induce production of these important signalling molecules. To address these issues, we have performed experiments in murine peritoneal macrophages to determine whether lipopolysaccharide (LPS) or interferon gamma (IFN-gamma) initiate production of the proinflammatory monokine interleukin 6 (IL-6) concomitant with elevations in [Ca2+]i and with kinetics similar to that seen with known Ca2+ mobilizing agents. Alterations in [Ca2+]i after treatment with LPS, IFN-gamma, platelet activating factor (PAF), or thapsigargin were measured by fluorimetric methods. These effects were compared with the ability of each to induce IL-6 mRNA expression as measured by semiquantitative reverse-transcribed polymerase chain reactions. We report that neither LPS nor IFN-gamma elicited detectable elevations in [Ca2+]i but that both up-regulated expression of IL-6 mRNA expression within 60 min. In contrast, experiments using either thapsigargin or PAF showed rapid and dramatic elevations in [Ca2+]i with marked increases in IL-6 mRNA expression, as quickly as 15 min after initial exposure. Elevations in mRNA encoding IL-6 by thapsigargin and PAF were found to occur in a dose-dependent manner, mirroring their ability to elicit elevations in [Ca2+]i. These data demonstrate that LPS and IFN-gamma induce IL-6 message expression by means of Ca2+-independent signalling pathways. Furthermore, Ca2+-mobilizing agents that evoke monokine message expression do so far more rapidly than do LPS or IFN-gamma. Taken in concert, these data are consistent with the hypothesis that multiple signalling pathways exist by which production of proinflammatory monokines are initiated.

Osteoblasts Express the Inflammatory Cytokine Interleukin-6 in a Murine Model of Staphylococcus aureus Osteomyelitis and Infected Human Bone Tissue

“…The identity of the PCR amplified fragments were verified by size comparison with DNA standards (Promega), and by direct DNA sequencing of representative fragments as previously described. 10,11 PCR products from the same series of experiments are shown throughout this manuscript for comparison purposes.…”

“…10,11 PCR was performed on the reverse transcribed cDNA product to determine the expression of IL-6, as previously described. 4,11 Positive and negative strand PCR primers used, respectively, were GATGCAACCAAACTG-GATATAATC and GGTCCTTAGCCACTCCTTCTCTG to amplify mRNA encoding IL-6 (268 bp fragment), and CCATCACCATCTTCCAGGAGCGAG and CACAGTCT-TCTGGGTGGCAGTGAT to amplify mRNA encoding G3PDH (340 bp fragment). PCR primers were derived from the published sequences of IL-6 12 and G3PDH.…”

G-Protein-coupled receptor agonists differentially regulate basal or tumor necrosis factor-α-stimulated activation of interleukin-6 and RANTES in human airway smooth muscle cells

“…Here, we show Tg differentially modulates the expression of proinflammatory proteins in ASM cells that is, an increase in IL-6 secretion in basal and TNF-astimulated conditions and an inhibition of RAN-TES in cytokine-treated cells. Previous studies, performed in murine peritoneal macrophages, also showed similar stimulatory effect of Tg on IL-6 gene [31,42], suggesting that depletion of intracellular calcium stores (notably SERCA-associated stores) is an important signal in the regulation of IL-6 gene as shown by the ability of Tg alone to stimulate the IL-6 promoter activity. These results strongly suggest that GPCR-sensitive intracellular calcium stores may represent an important component involved in the regulation of gene expression in human ASM cells by both cytokines and GPCR agonists.…”

Induction of Colony-Stimulating Factor Expression followingStaphylococcusorSalmonellaInteraction with Mouse or Human Osteoblasts

“…At the indicated times, RNA was extracted from cultured mouse osteoblasts, reverse transcribed, and subjected to semiquantitative reverse transcription (RT)-PCR as previously described (6)(7)(8)(9)47). Briefly, total RNA was isolated using TRIZOL Reagent (Gibco-BRL, Gaithersburg, Md.)…”