Differential and Inefficient Splicing of a Broadly Expressed Drosophila erect wing Transcript Results in Tissue-Specific Enrichment of the Vital EWG Protein Isoform

Abstract

In this report, we document an unusual mode of tissue-enriched gene expression that is primarily mediated by alternative and inefficient splicing. We have analyzed posttranscriptional regulation of the Drosophila erect wing gene, which provides a vital neuronal function and is essential for the formation of certain muscles. Its predominant protein product, the 116-kDa EWG protein, a putative transcriptional regulator, can provide all known erect wing-associated functions. Moreover, consistent with its function, the 116-kDa protein is highly enriched in neurons and is also observed transiently in migrating myoblasts. In contrast to the protein distribution, we observed that erect wing transcripts are present in comparable levels in neuron-enriched heads and neuron-poor bodies of adult Drosophila. Our analyses shows that erect wing transcript consists of 10 exons and is alternatively spliced and that a subset of introns are inefficiently spliced. We also show that the 116-kDa EWG protein-encoding splice isoform is head enriched. In contrast, bodies have lower levels of transcripts that can encode the 116-kDa protein and greater amounts of unprocessed erect wing RNA. Thus, the enrichment of the 116-kDa protein in heads is ensured by tissue-specific alternative and inefficient splicing and not by transcriptional regulation. Furthermore, this regulation is biologically important, as an increased level of the 116-kDa protein outside the nervous system is lethal.Most eukaryotic primary RNA transcripts undergo posttranscriptional processing requiring splicing of introns. The bestappreciated regulatory outcome of posttranscriptional processing is alternatively spliced transcripts that differ in the coding exons or have distinct 3Ј or 5Ј untranslated ends (reviewed in reference 32). A second consequence of posttranscriptional regulation is the modulation of amounts of specific transcripts dependent on differential splicing efficiencies of different splice sites. It is generally thought that differences in cell-type-specific splicing machineries result in cell type-enriched or -specific alternative splicing (5, 19). In addition, efficiency of splicing could play a major role in gene regulation as primary transcripts that are not completely processed are generally not transported to the cytoplasm and are unlikely to code functional proteins (6,21,23). We decided to investigate the role of alternative and inefficient splicing in the regulation of the Drosophila erect wing (ewg) gene, as previous studies indicated a complex transcript profile, intron-containing cDNAs, as well as poly(A) ϩ transcripts with retained introns (9). The Drosophila ewg gene provides a function that is vital in the nervous system and essential to the development of certain muscles (16). EWG protein contains an unusual DNA binding domain that is homologous to sea urchin P3A2 protein (4, 10), zebrafish Nrf (3), and mammalian transcription factors NRF-1 and initiation binding receptor (13,18,31). Our previous studies suggested that ewg primary transcrip...

Conserved Regions of the Drosophila Erect Wing Protein Contribute Both Positively and Negatively to Transcriptional Activity

“…Expression of the 116-kDa form of EWG is enriched in the Drosophila nervous system because of differential efficiency of splicing (4). Several other splice variants of ewg mRNA have been described with the potential of encoding additional EWG isoforms.…”

“…Our studies suggest that the essential function of EWG in the developing Drosophila nervous system is to regulate expression of specific target genes. Two ewg mutants have been molecularly characterized; both introduce early stop codons before the DNA binding/dimerization domain 3 (4). Characterization of additional ewg mutant alleles should help confirm that the functional domains we have identified contribute to EWG function in vivo.…”

“…During pupal development, EWG is expressed in the myoblasts that give rise to the indirect flight muscles (3). The expression of EWG is regulated posttranscriptionally; the regulated efficiency of the splicing of the ewg transcript leads to an enrichment of the mRNA encoding the 116-kDa, 733-amino acid-long form of the EWG protein in the nervous system (4). The expression of a cDNA encoding the 116-kDa form of EWG in neurons rescues the lethality caused by loss-of-function mutations in ewg, and broad expression of this cDNA also restores muscle development, indicating that the 116-kDa form of the protein can provide all known ewg activities (2,3).…”

ELAV-Mediated 3′-End Processing of ewg Transcripts Is Evolutionarily Conserved Despite Sequence Degeneration of the ELAV-Binding Site

“…Polyacrylamide gels from the analysis of 32 P-labeled PCR products were dried, exposed to phosphoimager screens (BioRad), and quantified with QuantityOne (BioRad). cDNAs from all ewg transcripts were amplified with primers 4F and 5R, eeF and eeR, 6F and 6R, or VSV-R (Koushika et al 1999;Soller and White 2003). Primers for the amplification of elav were elavFhinge (CTAAGCTTGGGCAGCACCAGTAAGATCA TCCAG) and elavBamR (GTGGGATCCTTGACAATCTTTAC CG).…”

The Neuron-Enriched Splicing Pattern of Drosophila erect wing Is Dependent on the Presence of ELAV Protein

“…Alternative splicing in two regions leads to enrichment in heads of the transcript with an open reading frame (ORF) that encodes the 116-kDa protein containing an unusual DNA binding domain. Further, misregulation is biologically consequential, as global expression of the 116-kDa protein can be lethal (27).The Drosophila embryonic lethal abnormal visual system (elav) gene encodes a neuron-specific RNA binding protein and is expressed in all neurons (44). Since Drosophila ELAV has been shown to be important for the formation of the neuron-specific protein isoform of Neuroglian (26), we investigated if ELAV also has a role in ewg regulation.…”