Different Pathophysiology of Gastritis between East and West? An Asian Perspective

Suzuki, Hidekazu; Mori, Hideki

doi:10.1159/000446301

Cited by 25 publications

(14 citation statements)

References 50 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Primer sequence (5′ to 3′) Size of PCR products (bp) References 16S rRNA-forward GCGCAATCAGCGTCAGGTAATG 502 Mona et al (2015) 16S rRNA -Reverse GCTAAGAGAGCAGCCTATGTCC CagA-Forward TTGACCAACAACCACAAACCGAAG 183 Smith et al (2002) CagA-Reverse CTTCCCTTAATTGCGAGATTCC adenocarcinoma which occurs most commonly in East Asian countries than western countries (Higashi et al, 2002;Suzuki and Mori, 2016). Since the discovery of H. pylori by Marshall and Warren (1984), it has been confirmed that H. pylori infection results in chronic active gastritis and can lead to gastric ulcer, duodenal ulcer and gastric cancer (Malfertheiner et al, 2007;Yamaoka, 2010).…”

Section: Region Amplifiedmentioning

confidence: 99%

Helicobacter pylori cytotoxin-associated gene A protein among adult dyspeptic patients in South-western Nigeria

Seriki¹,

Smith²,

Adeleye³

et al. 2017

Afr. J. Microbiol. Res.

View full text Add to dashboard Cite

cagA gene, a marker for the cag pathogenicity island (CagPAI) and a virulent factor in Helicobacter pylori infection codes for 120 to 145 kDa protein that is associated with cytotoxin production and more severe clinical outcomes. The aim of this study was to determine whether any correlation exists between H. pylori CagA protein and the endoscopic findings among dyspeptic patients from Southwestern, Nigeria and also to investigate the evolutionary relationships among H. pylori cagA gene with the GenBank strains. A total of one hundred and twenty four H. pylori positive isolates were amplified for the detection of cagA by polymerase chain reaction (PCR) and H. pylori isolates positive for cagA were further evaluated for protein expression using western blotting analysis. Also, DNA sequencing, blasting and phylogenetic analysis were performed on twelve selected isolates positive for cagA. cagA gene was detected in all the 124 samples (100%) and protein expressions of cagA by western blotting analysis was 88.7% (110/124). There was a high prevalence (91.7%) of expressed cagA strains in patients with positive endoscopic lesions than those with normal endoscopic findings (85.7%); however, association was not statistically significant (P>0.05). Also, the expressed cagA had no statistically significant association with all the positive endoscopic findings (P>0.05). Phylogenetic analysis of the selected H. pylori cagA gene showed high similarity with some GenBank strains of western cagA H. pylori. This study shows that CagA is high among dyspeptic patients in Nigeria but with no statistically significant association with the endoscopic findings.

show abstract

Section: Region Amplifiedmentioning

confidence: 99%

Helicobacter pylori cytotoxin-associated gene A protein among adult dyspeptic patients in South-western Nigeria

Seriki¹,

Smith²,

Adeleye³

et al. 2017

Afr. J. Microbiol. Res.

View full text Add to dashboard Cite

show abstract

“…Since 2013, H. pylori eradication therapy was approved for all cases of H. pylori gastritis by the national health insurance scheme in Japan, before other countries. From the global scale, a higher incidence of gastric cancer is found in Asia than in Europe and North America [ 5 , 6 ]. In managing effective H. pylori suppression, prevalence of H. pylori infection and incidence of resistance to antimicrobial agents in each region are important factors.…”

Section: Introductionmentioning

confidence: 99%

World trends for H. pylori eradication therapy and gastric cancer prevention strategy by H. pylori test-and-treat

2017

Self Cite

View full text Add to dashboard Cite

Helicobacter pylori-associated gastritis leads to the development of gastric cancer. Kyoto global consensus report on H. pylori gastritis recommended H. pylori eradication therapy to prevent gastric cancer. To manage H. pylori infection, it is important to choose the appropriate regimen considering regional differences in resistance to clarithromycin and metronidazole. Quinolones and rifabutin-containing regimens are useful as third- and fourth-line rescue therapies.

show abstract

“…28,29 Seropositive patients for H pylori and CagA have 5.8-fold higher risk of developing GC compared to non-infected individuals, whereas patients with cagA-negative strains have 2.2-fold higher risk. 28,29 Seropositive patients for H pylori and CagA have 5.8-fold higher risk of developing GC compared to non-infected individuals, whereas patients with cagA-negative strains have 2.2-fold higher risk.…”

Section: Discussionmentioning

confidence: 99%

“…The incidence rate of GC is higher in Asia than in Europe and Northern America due to higher prevalence of more virulent H pylori isolates in those regions. 28,29 Seropositive patients for H pylori and CagA have 5.8-fold higher risk of developing GC compared to non-infected individuals, whereas patients with cagA-negative strains have 2.2-fold higher risk. 6 We found a significant association between cagA-positive strains and severity of the disease: 35.3% vs 81.8% in the mild-and severe-disease group, respectively.…”

Section: Discussionmentioning

confidence: 99%

Helicobacter pylori pathogenicity and primary antimicrobial resistance in Northern Spain

Fernández‐Reyes

Tamayo

Rojas-Rengifo

et al. 2019

Eur J Clin Investigation

View full text Add to dashboard Cite

Background:Helicobacter pylori infection is associated with chronic gastritis, ulcers and gastric cancer. Antimicrobial resistance has increased worldwide affecting the efficacy of current treatments. Most guidelines recommend implementation of regional surveillance of primary antibiotic resistance of H pylori. Only a fraction of individuals infected with H pylori develop gastric diseases which are related to virulence factors of the bacteria. The aims of the study were to determine the primary antimicrobial resistance rates of H pylori and to know the virulence factors prevalence of strains circulating in Southern Europe. Materials and Methods: Susceptibility testing by Etest to clarithromycin, levofloxacin, metronidazole, amoxicillin and tetracycline was performed in 102 isolates (99 naïve patients). The prevalence of virulence factors (cagA, vacA, oipA, babA and dupA) was evaluated in 102 H pylori isolates from patients with mild-disease symptoms and in 22 isolates from patients with severe-disease symptoms. Results: Primary resistance rates were 12.1% to clarithromycin, 13.1% to levofloxacin, 24.2% to metronidazole and 0% to amoxicillin and tetracycline. Combined resistance to clarithromycin and levofloxacin was 3% and to clarithromycin and metronidazole 4%. Prevalence of virulence factors in the mild-and severe-disease group was 35.3% and 81.8% for cagA, 20.6% and 54.5% for cagA/vacAs1m1, 94.1% and 95.4% for babA2, 78.4% and 100% for oipA and 30.4% and 18.2% for dupA. Conclusions: Primary antimicrobial resistance rates were under 15% for clarithromycin and levofloxacin. The prevalence of H pylori carrying the virulent genotype cagA/vacAs1m1 was higher than 20% in the mild-disease and 54% in the severe-disease symptom group.

show abstract

Different Pathophysiology of Gastritis between East and West? An Asian Perspective

Cited by 25 publications

References 50 publications

Helicobacter pylori cytotoxin-associated gene A protein among adult dyspeptic patients in South-western Nigeria

Helicobacter pylori cytotoxin-associated gene A protein among adult dyspeptic patients in South-western Nigeria

World trends for H. pylori eradication therapy and gastric cancer prevention strategy by H. pylori test-and-treat

Helicobacter pylori pathogenicity and primary antimicrobial resistance in Northern Spain

Contact Info

Product

Resources

About