Different methylation of the TNF-alpha promoter in cortex and substantia nigra: Implications for selective neuronal vulnerability

Pieper, Heike C.; Evert, Bernd O.; Kaut, Oliver; Riederer, Peter; Waha, Andreas; Wüllner, Ullrich

doi:10.1016/j.nbd.2008.09.010

Cited by 96 publications

(66 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…DNA isolation and bisulfate treatment was performed as previously described (Pieper et al, 2008). Bisulfite-treated DNA was amplified using SYN-PromF AAAATTTTGAAGATATTTGAATTAAAG/SYN-PromR-CTAATCCTCCTCCTTCTCCTTCTC and SYN-IntF-GGAGTTTAAGGAA-AGAGATTTGATT/SYN-IntR-CAAACAACAAACCCAAATATAATAA, specifically designed for the bisulfite-treated DNA.…”

Section: Methodsmentioning

confidence: 99%

Methylation Regulates Alpha-Synuclein Expression and Is Decreased in Parkinson's Disease Patients' Brains

Jowaed¹,

Schmitt²,

Kaut³

et al. 2010

J. Neurosci.

388

346

View full text Add to dashboard Cite

Alpha-synuclein (SNCA) is a major risk gene for Parkinson's disease (PD), and increased SNCA gene dosage results in a parkinsonian syndrome in affected families. We found that methylation of human SNCA intron 1 decreased gene expression, while inhibition of DNA methylation activated SNCA expression. Methylation of SNCA intron 1 was reduced in DNA from sporadic PD patients' substantia nigra, putamen, and cortex, pointing toward a yet unappreciated epigenetic regulation of SNCA expression in PD.

show abstract

Section: Methodsmentioning

confidence: 99%

Methylation Regulates Alpha-Synuclein Expression and Is Decreased in Parkinson's Disease Patients' Brains

Jowaed¹,

Schmitt²,

Kaut³

et al. 2010

J. Neurosci.

388

346

View full text Add to dashboard Cite

show abstract

“…Increased levels of TNF-α is associated with dopaminergic cell death in PD. A study conducted by Pieper and co-workers reported that hypomethylation of the TNF-α promoter in SNpc cells may explain the increased susceptibility of dopaminergic neurons to TNF-α mediated inflammatory reactions [13]. The list of implicated genes in DNA methylation is by no means solely restricted to α-synuclein and TNF-α, as a number of significant loci have been experimented by Plagnol et al [14].…”

Section: Epigenetic Involvement In Parkinson's Diseasementioning

confidence: 99%

Bridging the Genetical Environmental Gap in Parkinson's Disease through Epigenetics

Shueb¹,

Sánchez²,

DeWeerdt³

et al. 2016

J Clin Epigenet

View full text Add to dashboard Cite

Parkinson's Disease (PD) is a progressive neurodegenerative disorder affecting 2% of the population over 60 years old, yet the exact molecular mechanism underlying its pathogenesis remains elusive. PD is a multifactorial disease with genetic and environmental factors intricately associated.Recently, epigenetic mechanisms have been recognized as potential mediators of environmental factors participating in the pathogenesis of PD. Epigenetics refer to the heritable changes in gene expression that do not involve changes to the underlying DNA sequence. Altered epigenetic mechanisms have been attributed to PD, Alzheimer's and Huntington's disease. Several studies have shown that DNA methylation, histone modifications and non-coding RNAs mechanisms contribute to the pathogenesis of PD. Accumulation of toxic metals such as manganese and iron, due to abnormal environmental exposure or increased dietary intake, can impact varied components of the epigenetic machinery through free radical formation.Current pharmacological agents only provide symptomatic relief, of which levodopa still remains the gold standard. However, drugs that halt or delay progression of PD are still lacking. In recent years, there has been considerable progress in the development of epigenetic drugs as a novel therapeutic modality in the management of PD. Cell replacement therapy is a promising avenue for the treatment of PD with scientific research making great progress in the development of Induced Pluripotent Stem Cells (iPSCs) to produce midbrain dopamine phenotypes. With direct access to the neurons that are affected in PD, the pace of discovery should speed up and the cure for PD should become an attainable goal.

show abstract

“…The genetic components responsible for their development have already been discussed above. Clinical studies aimed at treatment of Alzheimer's have affirmed a possible approach wherein in vitro or dietary administration of the components required for production of SAM like folate, homocysteine and B -group vitamins can be utilized to restore methylation levels of PSEN1, protract brain atrophy and minimize oxidative stress (Figure 3) [76][77][78][79][80][81][82][83][84][85][86][87][88][89][90][91][92][93][94]. In addition, several HDAC inhibitors have been developed for the therapeutic strategies targeted for Alzheimer's.…”

Section: Epigenetic Therapeutics Of Neurodegenerative Disordersmentioning

confidence: 99%

Implication of Epigenetic Modifications in Neurodegenerative Disorders: Traces and Imprints

Singh¹,

Satapathy²,

Singh³

et al. 2016

J Clin Cell Immunol

View full text Add to dashboard Cite

Different methylation of the TNF-alpha promoter in cortex and substantia nigra: Implications for selective neuronal vulnerability

Cited by 96 publications

References 28 publications

Methylation Regulates Alpha-Synuclein Expression and Is Decreased in Parkinson's Disease Patients' Brains

Methylation Regulates Alpha-Synuclein Expression and Is Decreased in Parkinson's Disease Patients' Brains

Bridging the Genetical Environmental Gap in Parkinson's Disease through Epigenetics

Implication of Epigenetic Modifications in Neurodegenerative Disorders: Traces and Imprints

Contact Info

Product

Resources

About