Differences in transport function of the human and rat orthologue of the Organic Anion Transporting Polypeptide 2B1 (OATP2B1)

Hußner, Janine; Foletti, Annalise; Seibert, Isabell; Fuchs, Anja; Schuler, Eveline; Malagnino, Vanessa; Grube, Markus; Schwabedissen, Henriette E. Meyer zu

doi:10.1016/j.dmpk.2021.100418

Cited by 8 publications

(13 citation statements)

References 55 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…is not present in HeLa cells (Ferreira et al, 2018;Wang et al, 2019), and the rOATP2B1 lacks the C-terminal sequence (Hussner et al, 2021). Accordingly, PDZK1 is not of relevance for our in vitro findings, but it exemplifies the existence of interplay-coordinating factors.…”

Section: Discussionmentioning

confidence: 74%

“…It remains challenging to elucidate whether one of them contributes to the observed marginal changes in rMRP2 in our rat models. Especially, considering that several known regulating endogenous substrates of human OATP2B1, such as sulfated steroids, are not transported by rOATP2B1 (Hussner et al, 2021).…”

Section: Discussionmentioning

confidence: 99%

“…This scaffold protein is known to contribute to the formation of a functional complex of multiple transporters in renal tubular cells (Anzai et al, 2007). Nevertheless, PDZK1 is not present in HeLa cells (Ferreira et al, 2018; Wang et al, 2019), and the rOATP2B1 lacks the C‐terminal sequence (Hussner et al, 2021). Accordingly, PDZK1 is not of relevance for our in vitro findings, but it exemplifies the existence of interplay‐coordinating factors.…”

Section: Discussionmentioning

confidence: 99%

“…In this study, multiple plasmids were used. The plasmid encoding for hOATP2B1 ( SLCO2B1 ‐pEF6) and rOATP2B1 ( rSlco2b1 ‐pEF6) were generated as described elsewhere (Hussner et al, 2021; Knauer et al, 2010). For the preparation of ABCC2 ‐pEF6, we used the primers ABCC2 _for 5′‐TCCAGGAATCATGCTGGAGAAGTTCTGC‐3′ and ABCC2 _rev 5′‐GGGCCTTCTGCTAGAATTTTGTGCTGTTCACATTC‐3′ with human liver cDNA for amplification prior to ligation into pEF6‐V5/HIS‐TOPO (Thermo Fisher Scientific).…”

Section: Methodsmentioning

confidence: 99%

See 3 more Smart Citations

Influence of Slco2b1‐knockout and SLCO2B1‐humanization on coproporphyrin I and III levels in rats

Kinzi,

Hussner,

Schäfer

et al. 2023

British J Pharmacology

Self Cite

View full text Add to dashboard Cite

Background and PurposeCoproporphyrin (CP) I and CPIII are byproducts of the heme synthesis currently investigated as biomarkers for drug‐drug interactions involving hepatic Organic Anion Transporting Polypeptide (OATP) 1B transporters. Another hepatically expressed member of the OATP‐family is OATP2B1. Aim of this study was to test the impact of OATP2B1, which specifically transports CPIII, on CP serum levels applying novel rat models.Experimental ApproachCPIII transport kinetics and the interplay between OATP2B1 and MRPs were determined in vitro using the vTF7 expression system. Novel rSlco2b1‐/‐ and SLCO2B1+/+ rat models were characterized for physiological parameters, and for coproporphyrin serum levels. Hepatic and renal expression of transporters involved in CP disposition were determined by real‐time qPCR, Western blot analysis and immunohistochemistry.Key ResultsIn vitro experiments revealed differences in transport kinetics comparing human and rat OATP2B1, and showed a consistent, species‐specific interplay with hMRP3/rMRP3. Deletion of rOATP2B1 was associated with a trend towards lower CPI serum levels compared to wildtype rats, while CPIII remained unchanged. Comparing SLCO2B1+/+ with knockout rats revealed an effect of sex: only in females, the genetic modification influenced CP serum levels. Analysis of hepatic and renal transporters revealed marginal, but in part, statistically significant differences in rMRP2 abundance, which may contribute to the observed changes in CP serum levels.Conclusion and ImplicationsOur findings support that factors other than OATP1B‐transporters are of relevance for basal CP levels. Only in female rats, humanization of SLCO2B1 affects basal CPI and CPIII serum levels, despite isomer selectivity of OATP2B1.

show abstract

Section: Discussionmentioning

confidence: 74%

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

Influence of Slco2b1‐knockout and SLCO2B1‐humanization on coproporphyrin I and III levels in rats

Kinzi,

Hussner,

Schäfer

et al. 2023

British J Pharmacology

Self Cite

View full text Add to dashboard Cite

show abstract

“…In any case, the current study provided proof for decision-making during hospitalization to a certain extent. Thirdly, Numerous studies have shown that there are some differences betwen rat and human in isoform composition, expression and catalytic activities of drug-metabolising enzymes, therefore, clinical trials examining the combination of SMI with LOS need to be conducted ( Martignoni et al, 2006 ; Hussner et al, 2021 ).…”

Section: Discussionmentioning

confidence: 99%

Evaluation of Potential Herb-Drug Interactions Between Shengmai Injection and Losartan Potassium in Rat and In Vitro

et al. 2022

View full text Add to dashboard Cite

Aim: The present study aimed to explore the potential herb-drug interactions (HDI) between Shengmai injection (SMI) and losartan potassium (LOS) based on the expression profiles of cytochromes P450 (CYP450) and drug transporters in rat and in vitro.Methods: Different concentrations of SMI were used to explore the influence of SMI on the antihypertensive efficacy of LOS in the hypertension rat model established by N (omega)-nitro-L-arginine methyl ester (L-NAME) for 4 weeks. Subsequently, the serum concentration levels of LOS and losartan carboxylic acid (EXP3174) were determined by Liquid Chromatography Mass Spectrometry (LC-MS) and pharmacokinetic analysis. Human liver microsomes, human multidrug resistance protein 1 (MDR1/P-gp), and breast cancer resistance protein (BCRP) vesicles, human embryonic kidney 293 cell line with stable expression of the organic anion transporting polypeptide 1B1 (HEK293-OATP1B1 cells) and mock-transfected HEK293 (HEK293-MOCK) cells were used to verify the effects of SMI on CYP450 enzymes and drug transporters in vitro.Results: Low, medium, and high concentrations of SMI increased the antihypertensive efficacy of LOS to varying degrees. The high dose SMI increased the half-life (t1/2), the maximum plasma concentration (Cmax), the area under the plasma concentration-time curve (AUC) from time zero to the time of the last measurable plasma concentration (AUC0-t), AUC from time zero to infinity (AUC0-∞), and mean residence time (MRT) values of LOS and decreased its apparent volume of distribution (Vd) and clearance (CL) values. The AUC0-t, AUC0-∞, and MRT of LOS were increased, whereas the CL was decreased by the medium concentration of SMI. In addition, the high, medium, and low doses of SMI increased the relative bioavailability (Frel) of LOS. SMI exhibited no significant effects on the pharmacokinetics of EXP3174. In vitro, SMI exhibited different suppressive effects on the enzyme activity levels of CYP1A2 (6.12%), CYP2B6 (2.72%), CYP2C9 (14.31%), CYP2C19 (12.96%), CYP2D6 (12.26%), CYP3A4 (3.72%), CYP2C8 (10.00–30.00%), MDR1 (0.75%), OATP1B1(2.03%), and BCRP (0.15%).Conclusion: In conclusion, SMI improved the antihypertensive efficacy of LOS in the L-NAME-induced hypertension rat model by increasing the concentration of LOS, while leaving the concentration of EXP3174 intact. SMI affected the pharmacokinetic properties of LOS by decreasing the elimination of LOS. These effects might partly be attributed to the inhibition of the activities of CYP3A4, CYP2C9, and of the drug transporters (P-gp, BCRP, and OATP1B1) by SMI, which need further scrutiny.

show abstract

Physiologically based pharmacokinetics modeling and transporter proteomics to predict systemic and local liver and muscle disposition of statins

Prieto Garcia,

Vildhede,

Nordell

et al. 2024

CPT Pharmacom & Syst Pharma

View full text Add to dashboard Cite

Statins are used to reduce liver cholesterol levels but also carry a dose‐related risk of skeletal muscle toxicity. Concentrations of statins in plasma are often used to assess efficacy and safety, but because statins are substrates of membrane transporters that are present in diverse tissues, local differences in intracellular tissue concentrations cannot be ruled out. Thus, plasma concentration may not be an adequate indicator of efficacy and toxicity. To bridge this gap, we used physiologically based pharmacokinetic (PBPK) modeling to predict intracellular concentrations of statins. Quantitative data on transporter clearance were scaled from in vitro to in vivo conditions by integrating targeted proteomics and transporter kinetics data. The developed PBPK models, informed by proteomics, suggested that organic anion–transporting polypeptide 2B1 (OATP2B1) and multidrug resistance–associated protein 1 (MRP1) play a pivotal role in the distribution of statins in muscle. Using these PBPK models, we were able to predict the impact of alterations in transporter function due to genotype or drug–drug interactions on statin systemic concentrations and exposure in liver and muscle. These results underscore the potential of proteomics‐guided PBPK modeling to scale transporter clearance from in vitro data to real‐world implications. It is important to evaluate the role of drug transporters when predicting tissue exposure associated with on‐ and off‐target effects.

show abstract

Differences in transport function of the human and rat orthologue of the Organic Anion Transporting Polypeptide 2B1 (OATP2B1)

Cited by 8 publications

References 55 publications

Influence of Slco2b1‐knockout and SLCO2B1‐humanization on coproporphyrin I and III levels in rats

Influence of Slco2b1‐knockout and SLCO2B1‐humanization on coproporphyrin I and III levels in rats

Evaluation of Potential Herb-Drug Interactions Between Shengmai Injection and Losartan Potassium in Rat and In Vitro

Physiologically based pharmacokinetics modeling and transporter proteomics to predict systemic and local liver and muscle disposition of statins

Contact Info

Product

Resources

About