Differences in Macrophage Activation by Bacterial DNA and CpG-Containing Oligonucleotides

Abstract

Bacterial DNA activates mouse macrophages, B cells, and dendritic cells in a TLR9-dependent manner. Although short ssCpG-containing phosphodiester oligonucleotides (PO-ODN) can mimic the action of bacterial DNA on macrophages, they are much less immunostimulatory than Escherichia coli DNA. In this study we have assessed the structural differences between E. coli DNA and PO-ODN, which may explain the high activity of bacterial DNA on macrophages. DNA length was found to be the most important variable. Double-strandedness was not responsible for the increased activity of long DNA. DNA adenine methyltransferase (Dam) and DNA cytosine methyltransferase (Dcm) methylation of E. coli DNA did not enhance macrophage NO production. The presence of two CpG motifs on one molecule only marginally improved activity at low concentration, suggesting that ligand-mediated TLR9 cross-linking was not involved. The major contribution was from DNA length. Synthetic ODN >44 nt attained the same levels of activity as bacterial DNA. The response of macrophages to CpG DNA requires endocytic uptake. The length dependence of the CpG ODN response was found to correlate with the presence in macrophages of a length-dependent uptake process for DNA. This transport system was absent from B cells and fibroblasts.

Bacterial DNA Containing Methylated CpG Motifs Retains Immunostimulatory Activity in Synergy with Modified Lipopolysaccharides

“…In macrophages, E. coli DNA exhibited a higher potency as compared with CpG-containing oligonucleotides, and the increased activity of E. coli was attributed to length-dependent cellular uptake of DNA (31). Maximal DNA uptake was reached at a length of 250 bp, which is in good agreement with our previous observation that E. coli DNA fragments ranging from 0.2 to 0.5 kb were the most effective for inducing cytokine secretion in vitro (9).…”

“…Langerhans' cell emigration and cytokine production were also stimulated by methylated CpG-containing plasmid DNA (11). DNA-mediated macrophage activation was dependent on the presence of unmethylated CpG motifs, but CpGmethylated DNA was also capable of activating macrophages at high concentrations (31). Taken together, these data demonstrate that unmethylated CpG motifs are not absolutely required for the immunostimulatory activity of bacterial DNA.…”

“…This difference between in vitro and in vivo activity of DNA fragments may attribute to higher chances of DNA fragments to be digested by nucleases in vivo. Studies using oligonucleotides revealed that longer oligonucleotides yielded higher uptakes and overcame the methylation effect of CpG motifs (31,40). Based on these data, it seems likely that the optimal size of E. coli DNA fragments in CIA07 contribute to the observed unmethylated CpG-independent immunostimulatory activity and antitumor effects.…”

Interleukin‐10 derived from macrophages and/or neutrophils regulates the inflammatory response to LPS but not the response to CpG DNA

“…Murine plasmacytoid and myeloid dendritic cells [25], mast cells (reviewed in [26]) as well as B cells [27], [28] express TLR9 and respond to bacterial DNA. Sensitivity to bacterial DNA and CpG oligonucleotides has been demonstrated for a murine macrophage cell line and for macrophages differentiated from mouse bone marrow in vitro [16], [17]. We show in the present paper that murine splenic macrophages secrete IL-10 in response to stimulation with CpG oligonucleotides.…”

Activation of TLR-9 Induces IL-8 Secretion through Peroxynitrite Signaling in Human Neutrophils

“…By contrast, human PMN were reported to synthesize IL-8 in response to a class A CpG oligonucleotide (GGTGCATCGATGCAGGGGGG) only if pretreated with GM-CSF (5). Although the biological actions of this oligonucleotide have not been fully characterized, short CpG oligonucleotides are generally less potent immunostimulators than E. coli DNA (2,34).…”