Development of the nitrogen fixing apparatus in the legumes, Centrosema pubescens Benth., and Vigna unguiculata L. Walp.

Abstract

The sequence of events leading up to the establishment of symbiotic nitrogen-fixation were studied in two tropical legumes, Centrosema pubescens Benth, and Vigna unguiculata L. Walp. Parameters measured included fresh and dry weights, chlorophyll and leghaemoglobin contents, as well as the activities of NADH-nitrate reductase (EC 1.6.6.1), and nitrogenase (nitric-oxide reductase-EC 1.7.99.2) in plants that were inoculated with suitable rhizobia or which were watered with potassium nitrate. Dry weight and photosynthetic activity of both species followed the sigmoidal pattern which is characteristic of most plants. Growth was little different in either a qualitative or quantitative sense whether nitrogen was supplied as nitrate or through dinitrogen fixation. Although the biochemical sequence of events was dependent on the limiting sensitivities of the individual assays used, the data suggest that nitrate reductase is the first measurable enzymatic activity in the nodules (and roots), followed by acetylene reduction and leghaemoglobin in that order. It is possible therefore, that low levels of symbiotic nitrogen fixation occur in the nodules in the absence of leghaemoglobin. Nitrate reductase activity in C. pubescens nodules was negatively exponentially correlated with nitrogenase activity of the same nodules, suggesting a changing metabolism in old nodules. These data are discussed in terms of environmental and physical factors known to control nitrogen fixation.

Accumulation of Transcripts Encodinga Lipid Transfer-Like Protein During Deformation ofNodulation-CompetentVigna unguiculataRoot Hairs

“…Similarly, we used V. unguiculata because: 1) relative to other legumes, it has a small genome-540 Mbp (W. J. Broughton, unpublished); 2) it is a true diploid (2n = 22); 3) it has a short generation time (60-90 days); 4) linkage maps comprising genomic, random amplified polymorphic DNA, cDNA, and morphological markers are available (Fatokun et al 1993); 5) it possesses one of the broadest capacities to nodulate of all known legumes (Lewin et al 1987); 6) it responds rapidly (Lewin et al 1990) and massively to inoculation with Rhizobium (Danso and Owiredu 1988); 7) it grows quickly and well under artificial conditions (Broughton et al 1978;Broughton 1979); 8) it produces a large amount of root hairs (Krause and CGCGAGTTCAGCATTAACAAATCATCACCCTTTGTTCTCTGTGTTGTTGT 50 TTTAGGAAGATGACGATGAAGATGAAGATGAAGATGTCGGTTGTGTGTGC 100 Broughton 1992); 9) it can be transformed with Agrobacterium tumefaciens (Garcia et al 1987); and I 0) it is widely cultivated, especially in Africa, India, and North America.…”

Proteins Associated with Root-Hair Deformation and Nodule Initiation inVigna unguiculata

“…This plant was chosen because: l) it is one of the most promiscuous known legumes (Lewin et al 1987); 2) it responds rapidly (Lewin et al 1990) and massively to inoculation (Danso and Owiredu 1988; Wong Kah-Lin and W. J. Broughton, unpublished); 3) it produces large amounts of root hairs (about 2 mg dry weight per 100 plants; A. Krause, unpublished); 4) it grows rapidly and well under artificial conditions (Broughton et al 1978;Broughton 1979); and 5) it can be transformed with Agrobacterium tumefaciens (Smith and Townsend) Conn based vectors (Garcia et al 1987;D. P. S. Verma, unpublished).…”