Development of primers and a procedure for specific identification of the diatom Thalassiosira weissflogii

Abstract

A recent study showed Thalassiosira weissflogii to be a diatom containing suitable nutrition for larviculture of the black tiger shrimp, Penaeus monodon. Accurate and practical identification of this diatom species is therefore important for commercial hatcheries. The purpose of this study was to establish a DNA-based method of identification to supplement morphological examination, avoiding confusion with other Thalassiosira sp. Primers, 18SF/28SR1, specific for ribosomal DNA genes (3 0 -end of 18S rDNA through 5 0 -end of 28S rDNA, covering two internal transcribed spacers), were employed as a first-step polymerase chain reaction, followed by a second nested amplification using specifically designed primers, ITS1-F-D/ITS1-R-D. The nested-PCR result revealed specificity in the detection, distinguishing T. weissflogii from T. pseudonana, Cyclotella meneghiniana, and Chaetoceros sp., and the PCR fragment of the amplified region had a sequence that was 99% identical to the T. weissflogii sequence held by GenBank.

The Transfer of the Ferredoxin Gene From the Chloroplast to the Nuclear Genome Is Ancient Within the Paraphyletic Genus Thalassiosira

“…We question the taxonomic identity of the strain classified as T. oceanica CCMP1616, after the petF gene failed to amplify with the primers used for the other T. oceanica strains ( Figure 2 ). The classification of this strain with the well-established eukaryotic barcoding region ITS2 ( Supplementary Figure S2 ; Coleman, 2003 , 2009 ; Sorhannus et al, 2010 ; Caisova et al, 2011 ; Senapin et al, 2011 ; Whittaker et al, 2012 ) showed that CCMP1616 is unlikely to belong to the T. oceanica species because it is not part of the highly supported monophyletic T. oceanica clade. The 18S phylogeny further indicates that it instead stands as an independent neighbor of the other Thalassiosira clades, which cluster well according to their assigned species ( Figure 4 ).…”

Physiological and Biochemical Responses in Microalgae Dunaliella salina, Cylindrotheca closterium and Phormidium versicolor NCC466 Exposed to High Salinity and Irradiation

“…Class-specific and genus-specific primers are generally designed to target the mature ribosomal RNA gene sequences of 16S, 23S, 18S, 5.8S, or 28S, which are considered to be large in size and highly conserved. In addition, internal transcribed sequences (ITS) that are more divergent are also used for species or strain identification [ 41 ]. In the present study, Oligonucleotide primers were utilized to amplify the 18S rDNA, 16Sr DNA, 5.8S, and rbcl genes of the tested microalgae ( Table 1 ).…”

Light and Nutrient Conditions Influence Fucoxanthin Production of the Microalgae Cyclotella meneghiniana

“…Primers, ITS1-F (5′CCGTAGGTGAACGTGCGGAAGGATC3′), (5′CGTATCGCATTTCGCTGCGTTCTTC3′) ITS1-R, were designed in this study. The polymerase chain reaction was conducted using 25 µL reaction mixtures composed of 1.0 µL of the first PCR product, 0.5 µL of 10 µL MdNTPs, 0.5 µL of 10 µM of each primer, and 0.25 µL of Taq DNA polymerase (5 units/µL, Invitrogen, Waltham, MA, USA), 0.5 µL of 50 mM MgCl2, 2.5 µL of 10 × PCR buffer, and 19.25× of ultra-pure distilled water according to the protocol [46]. Subsequently, the PCR products underwent purification through a Qiagen PCR kit and were sequenced by BGI Biotechnology (BGI, Shenzhen, China).…”

“…In conducting the phylogenetic study, we retrieved the Internal Transcribed Spacer regions of C. meneghiniana and related sequences from the NCBI database and discovered that the ITS gene sequences in this study were highly similar (100%) to Cyclotella meneghiniana BIMS-PP0014 [46]. A phylogram with closely related species constructed using ITS1 sequences of Cyclotella meneghiniana (Stephanocyclus meneghinianus) is shown in Figure S1.…”