Development of PCR-based markers linked to dominant genes for male-fertility restoration in Pampa CMS of rye (Secale cereale L.)

Abstract

Cytoplasmatic male sterility (CMS) is the basis for commercial hybrid seed production of rye. Nuclear restorer genes are indispensable for a complete restoration of fertility of the CMS lines. The drawbacks of current European restorer lines require the utilisation of new genetic resources that have been recently detected in an Iranian primitive rye population (IRAN IX) and an Argentinean landrace (Pico Gentario). The introgression of these effective restorer genes (Rfp1 and Rfp2, respectively) into breeding material can be facilitated by marker-assisted selection. Using two F(2) populations based on crosses between the non-restorer inbred line Lo6 and the restorer IRAN IX, as well as Pico Gentario, RAPDs and AFLPs were screened and led to a closely linked marker set for each of these genes. The conversion of the closest markers into fragment-specific sequence-characterised amplified region (SCAR) markers resulted in flanking ranges of 2.9 cM (Rfp1) and 5.2 cM (Rfp2). The application of these markers in backcross programmes is discussed.

New genetic map of rye composed of PCR-based molecular markers and its alignment with the reference map of the DS2 × RXL10 intercross

“…The sequence-characterized amplified regions (SCARs) used for mapping were from Stracke et al (2003) Gonzales et al (2002) (SCS4_756) and from a public database (OPQ4_578 = EMBL-AY587511, OPN1_667 = EMBL-AY587508). Three additional SCAR markers (SCSz732L_530, SCSz502_900 and SCSz980L_650) were converted from RAPDs in the course of this study.…”

DArT markers tightly linked with the Rfc1 gene controlling restoration of male fertility in the CMS-C system in cultivated rye (Secale cereale L.)

“…Between them, there were markers described by Stracke et al (2003), Milczarski et al (2007) and two newly developed SCAR markers obtained by sequencing RAPD fragments located on the 4RL chromosome (Stojałowski et al 2004). Sequences of primers for these markers are as follows:

Xscsz23L500 – CGAAGCAGACCCGTACACAT / CGAAGCAGACGAGGATATTT

Xscsz670L900 – GGACTGGAGTGATAAGGACG / GGACTGGAGTCTAATATATG.

…”

Molecular cytogenetic identification of a novel 1AL.1RS translocation line with powdery mildew resistance

“…However, molecular markers such as polymerase chain reaction (PCR)-based markers are more economical and cost-effective for performing marker-assisted selection unlike cytogenetic techniques; in particular, the genomic-and chromosome-specific markers are very efficient and have been widely de-veloped and used in wheat breeding (La Rota et al, 2005). Various markers have been developed for detecting rye chromatin and are used extensively, such as restriction fragment length polymorphism (Börner and Korzun, 1998), amplified fragment length polymorphism (Puente et al, 2008), random amplified polymorphic DNA (Ko et al, 2002), sequence-specific amplified polymorphism (Nagy and Lelley, 2003), simple sequence repeat (SSR) (Hackauf and Wehling, 2003), inter-simple sequence repeat (Hess et al, 2000), sequence-characterized amplified region (Stracke et al, 2003), and sequence-tagged sites (Mohler et al, 2001). The specific markers reported for detecting individual rye chromosomes can be used to develop a rapid and reliable marker system for screening wheat lines that contain rye chromatin; this system provides an efficient tool for the selection of desirable lines from large gene pools.…”