Development of New Mouse Lung Tumor Models Expressing EGFR T790M Mutants Associated with Clinical Resistance to Kinase Inhibitors

Regales, Lucía; Balak, Marissa N.; Gong, Yixuan; Politi, Katerina; Sawai, Ayana; Le, Carl; Koutcher, Jason A.; Solit, David B.; Rosen, Neal; Zakowski, Maureen F.; Pao, William

doi:10.1371/journal.pone.0000810

Cited by 110 publications

(109 citation statements)

References 23 publications

Supporting

Mentioning

102

Contrasting

Order By: Relevance

“…In one model (28), lung cancer is driven by inducible expression of the insertion mutation YVMA of ERBB2 (Her2/neu). In the other model (29), lung-specific induction of the double-mutant EGFR L858R/T790M (LTM) leads to erlotinib-resistant lung cancer growth in mice. In the ERBB2 YVMA mice, treatment with 150 mg/kg of GDC-0941 led to pronounced tumor shrinkage, whereas the lower dose (75 mg/kg) induced inhibition of tumor growth compatible with stable disease ( Fig.…”

Section: Resultsmentioning

confidence: 99%

Identifying genotype-dependent efficacy of single and combined PI3K- and MAPK-pathway inhibition in cancer

Sos

Fischer

Ullrich

et al. 2009

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

240

235

View full text Add to dashboard Cite

In cancer, genetically activated proto-oncogenes often induce ''upstream'' dependency on the activity of the mutant oncoprotein. Therapeutic inhibition of these activated oncoproteins can induce massive apoptosis of tumor cells, leading to sometimes dramatic tumor regressions in patients. The PI3K and MAPK signaling pathways are central regulators of oncogenic transformation and tumor maintenance. We hypothesized that upstream dependency engages either one of these pathways preferentially to induce ''downstream'' dependency. Therefore, we analyzed whether downstream pathway dependency segregates by genetic aberrations upstream in lung cancer cell lines. Here, we show by systematically linking drug response to genomic aberrations in non-small-cell lung cancer, as well as in cell lines of other tumor types and in a series of in vivo cancer models, that tumors with genetically activated receptor tyrosine kinases depend on PI3K signaling, whereas tumors with mutations in the RAS/RAF axis depend on MAPK signaling. However, efficacy of downstream pathway inhibition was limited by release of negative feedback loops on the reciprocal pathway. By contrast, combined blockade of both pathways was able to overcome the reciprocal pathway activation induced by inhibitor-mediated release of negative feedback loops and resulted in a significant increase in apoptosis and tumor shrinkage. Thus, by using a systematic chemo-genomics approach, we identify genetic lesions connected to PI3K and MAPK pathway activation and provide a rationale for combined inhibition of both pathways. Our findings may have implications for patient stratification in clinical trials.cancer genomics ͉ combination therapy ͉ high-throughput cell line screening ͉ oncogene dependency

show abstract

Section: Resultsmentioning

confidence: 99%

Identifying genotype-dependent efficacy of single and combined PI3K- and MAPK-pathway inhibition in cancer

Sos

Fischer

Ullrich

et al. 2009

Proc. Natl. Acad. Sci. U.S.A.

Self Cite

240

235

View full text Add to dashboard Cite

show abstract

“…Consistent with this idea, introduction of the T790M in tandem with the L858R mutant in NIH 3T3 cells increases EGFR activity and enhances the transformed phenotype (22). Transgenic mice engineered with lung-specific expression of the T790M mutant develop lung adenocarcinomas (23), albeit with a longer latency than those harboring the L858R or combined L858R and T790M mutations (23,24). The EGFR T790M mutation was also identified in an untreated case of Barrett's esophagus and the corresponding adenocarcinoma (25).…”

mentioning

confidence: 87%

The T790M mutation in EGFR kinase causes drug resistance by increasing the affinity for ATP

Yun¹,

Mengwasser²,

Toms³

et al. 2008

Proc. Natl. Acad. Sci. U.S.A.

1,738

1,480

View full text Add to dashboard Cite

Lung cancers caused by activating mutations in the epidermal growth factor receptor (EGFR) are initially responsive to small molecule tyrosine kinase inhibitors (TKIs), but the efficacy of these agents is often limited because of the emergence of drug resistance conferred by a second mutation, T790M. Threonine 790 is the ''gatekeeper'' residue, an important determinant of inhibitor specificity in the ATP binding pocket. The T790M mutation has been thought to cause resistance by sterically blocking binding of TKIs such as gefitinib and erlotinib, but this explanation is difficult to reconcile with the fact that it remains sensitive to structurally similar irreversible inhibitors. Here, we show by using a direct binding assay that T790M mutants retain low-nanomolar affinity for gefitinib. Furthermore, we show that the T790M mutation activates WT EGFR and that introduction of the T790M mutation increases the ATP affinity of the oncogenic L858R mutant by more than an order of magnitude. The increased ATP affinity is the primary mechanism by which the T790M mutation confers drug resistance. Crystallographic analysis of the T790M mutant shows how it can adapt to accommodate tight binding of diverse inhibitors, including the irreversible inhibitor HKI-272, and also suggests a structural mechanism for catalytic activation. We conclude that the T790M mutation is a ''generic'' resistance mutation that will reduce the potency of any ATP-competitive kinase inhibitor and that irreversible inhibitors overcome this resistance simply through covalent binding, not as a result of an alternative binding mode. lung cancer ͉ tyrosine kinase ͉ x-ray crystallography

show abstract

“…However, the presence of the T790M mutation renders tumors in these mice insensitive to treatment with first generation TKIs erlotinib and gefitinib. 24 To inhibit epithelial NF-kB signaling in the lungs of these mice, EGFR L/T mice were mated to transgenic DN-IkB mice (designated EGFR L/T DN-IkB). To determine the effect of epithelial NF-kB inhibition on EGFR TKI-resistant EGFR L/T tumors, mice were treated with dox for 8 weeks, and tumor burden was Fig.…”

Section: Nf-kb Inhibition Decreases Lung Tumors In Mice Expressing Amentioning

confidence: 99%

“…tet-O-EGFR L858R mice, 19 tet-O-EGFR L858RCT790M mice 24 (gifts from Dr. William Pao, Vanderbilt University), tet-O-IkBa-DN mice, 20 and CCSP-rtTA mice 37 and genotyping procedures have all been previously described. EGFR L858R and EGFR L/T transgenic mice were generated by mating tet-O-EGFR L858R or tet-O-EGFR L858RCT790M mice to homozygous CCSP-rtTA mice.…”

Section: Animal Modelsmentioning

confidence: 99%

“…RT-PCR was performed to measure EGFR L858R and EGFR L/T expression as previously described. 19,24 RT-PCR was also performed for DN-IkB and GAPDH using the following primers: DN-IkB (F: CCTGGCTGTTGTCGAATACC; R: GGTGATGGT-GATGATGACCGG), GAPDH (F: CCTGCACCACCAACTGCT-TAG; R: GTGGATGCAGGGATGATGTTC). Quantitative realtime PCR was performed using Sybr Green PCR Master Mix (Applied Biosystems) and the following primer sets: CCL2 (F: TTAAAAACCTGGATCGGAACCAA; R: GCATTAGCTTCA-GATTTACGGGT), M-CSF (F: GTGTCAGAACACTGTAGC-CAC; R: TCAAAGGCAATCTGGCATGAAG) (PrimerBank ID: 166064045c1), [39][40][41] …”

Section: Rna Isolation Rt-pcr and Quantitative Real-time Pcrmentioning

confidence: 99%

See 1 more Smart Citation

Epithelial NF-κB signaling promotes EGFR-driven lung carcinogenesis via macrophage recruitment

et al. 2016

View full text Add to dashboard Cite

Several studies have demonstrated that NF-kB activation is common in lung cancer; however, the mechanistic links between NF-kB signaling and tumorigenesis remain to be fully elucidated. We investigated the function of NF-kB signaling in epidermal growth factor receptor (EGFR)-mutant lung tumors using a transgenic mouse model with doxycycline (dox)-inducible expression of oncogenic EGFR in the lung epithelium with or without a dominant inhibitor of NF-kB signaling. NF-kB inhibition resulted in a significant reduction in tumor burden in both EGFR tyrosine kinase inhibitor (TKI)-sensitive and resistant tumors. However, NF-kB inhibition did not alter epithelial cell survival in vitro or in vivo, and no changes were detected in activation of EGFR downstream signaling pathways. Instead, we observed an influx of inflammatory cells (macrophages and neutrophils) in the lungs of mice with oncogenic EGFR expression that was blocked in the setting of NF-kB inhibition. To investigate whether inflammatory cells play a role in promoting EGFR-mutant lung tumors, we depleted macrophages and neutrophils during tumorigenesis and found that neutrophil depletion had no effect on tumor formation, but macrophage depletion caused a significant reduction in tumor burden. Together, these data suggest that epithelial NFkB signaling supports carcinogenesis in a non-cell autonomous manner in EGFR-mutant tumors through recruitment of pro-tumorigenic macrophages.

show abstract

Development of New Mouse Lung Tumor Models Expressing EGFR T790M Mutants Associated with Clinical Resistance to Kinase Inhibitors

Cited by 110 publications

References 23 publications

Identifying genotype-dependent efficacy of single and combined PI3K- and MAPK-pathway inhibition in cancer

Identifying genotype-dependent efficacy of single and combined PI3K- and MAPK-pathway inhibition in cancer

The T790M mutation in EGFR kinase causes drug resistance by increasing the affinity for ATP

Epithelial NF-κB signaling promotes EGFR-driven lung carcinogenesis via macrophage recruitment

Contact Info

Product

Resources

About