Development of microsatellite markers and a preliminary assessment of population structuring in the rice weevil, Sitophilus oryzae (L.)

Abstract

41The rice weevil, Sitophilus oryzae is one of the primary pests of stored grains worldwide. To 42 develop and implement an effective integrated pest management strategy, an understanding of the 43 population structuring of this destructive pest is vital. In this study we used Illumina paired-end 44 sequencing to develop S. oryzae species-specific microsatellite markers, and used these markers to 45 conduct a preliminary assessment of population structuring in four populations of S. oryzae from three 46 countries (Australia, China, and USA). 7,635,996 raw sequencing reads were produced, with 11,794 47 microsatellites detected and 214,257 primer options designed. 48 microsatellite markers were selected 48 for further validation, with 10 markers amplifying consistently across the four S. oryzae populations. 49These markers displayed a high level of polymorphism overall (6.67 alleles/locus), though this was 50 slightly lower within populations (3.10 -4.88 alleles/locus). We used the markers to conduct a 51 preliminary assessment of genetic structuring among the four S. oryzae populations: three laboratory 52 cultures (New South Wales, Queensland, and Santai) and a field collected population from Kansas. 53 Analyses suggest high levels of genetic differentiation between the sample locations, with a global F ST 54 of 0.239, and pairwise F ST values ranging from 0.100 to 0.395. Bayesian clustering analyses suggest 55 these four populations formed four distinct clusters, with a similar pattern identified by Principal 56 Coordinate Analysis. These microsatellite markers, together with our preliminary population genetic 57 analyses, will provide a valuable resource for population genetic research, and contribute to effective 58 integrated pest management strategies in the future. 59 60 61 62 63 4

Ancient origin and recent range expansion of the maize weevilSitophilus zeamais, and its genealogical relationship to the rice weevilS. oryzae

“…The lack of spatial genetic structure in Brazil is consistent with a pest species that: (a) has been introduced recently – more likely during the last few hundred years; (b) is capable of dispersing to short distances owing to its flying capabilities (Throne & Cline, 1989; Rees, 1996); (c) is capable of reaching new, distant territories owing to human-mediated transportation of infested grains (Longstaff, 1981; Throne & Cline, 1989; Plarre, 2010). High levels of gene flow and low genetic differentiation among populations constitute a pattern that very likely is not restricted to the maize weevil populations from Brazil; his pattern is probably widespread at a regional scale across other maize cultivation areas around the world (Semeao et al , 2012; Coelho-Bortolo et al , 2016; Thagaraj et al , 2016).…”

An integrative approach to discovering cryptic species within the Bemisia tabaci whitefly species complex

“…Genomic DNA from single male whiteflies representing each pure, inbred laboratory colony, was isolated using the silica spin-column method 83 and quantified using a Qubit® 2.0 fluorometer (Invitrogen). Genomic DNA ( ~ 30 ng in 100 µl of TE buffer) was sheared for 10 min using an ultrasonic cleaner (VGT-1620QTD) and size-selected (300–500 bp) using Blue pippin (Sage Science).…”

Insecticide resistance status of Bemisia tabaci MEAM1 (Hemiptera: Aleyrodidae) in Australian cotton production valleys

“…Thirty individuals from each population collected from 2010 to 2013 were screened using random amplified polymorphic DNA (RAPD) and sequence‐characterised simplified region (SCAR) based assays to differentiate between B. tabaci MEAM1 and AUSI (Boukhatem et al ; De Barro and Driver ). For each population collected in 2014–2017, genomic DNA of three single adult whiteflies was isolated using a silica spin‐column method (Thangaraj et al ) for species identification based on the 3′ barcoding region of the mitochondrial cytochrome oxidase 1 (mtCOI) gene (Dinsdale et al ). This region was amplified and sequenced using primers C1‐J‐2195 (5′‐TTGATTTTTTGGTCATCCAGAAGT‐3′) and TL2‐N‐3014 (5′‐TCCAATGCACTAATCTGCCATATTA‐3′) (Simon et al ).…”