Development of an improved real time PCR for the detection of bovine leukaemia provirus nucleic acid and its use in the clarification of inconclusive serological test results

Rola–Łuszczak, Marzena; Finnegan, Christopher; Olech, Monika; Choudhury, Bhudipa; Kuźmak, Jacek

doi:10.1016/j.jviromet.2013.02.014

Cited by 26 publications

(36 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Unlike serological assays, qPCR assays have the potential of detecting BLV DNA soon after BLV infection, when animals might present transient or very low levels of BLV-Abs (2,8,11,26,27). qPCR assays can also serve as confirmatory tests for the clarification of inconclusive and discordant serological test results (7). Moreover, qPCR allows not only the detection of BLV infection but also estimation of the BLV proviral load, which directly correlates with the risk of disease transmission (28,29).…”

Section: Discussionmentioning

confidence: 99%

“…(v) PL qPCR. The BLV qPCR was performed as published previously (7). A quantitative TaqMan PCR was carried out in a 25-l PCR mixture containing 12.5 l of 2ϫ QuantiTect Multiplex PCR NoROX master mix (Qiagen), 0.4 M each primer, 0.2 M specific BLV probe, and 500 ng of extracted genomic DNA.…”

Section: Description Of Blv Qpcr Protocols Used By Participating Labomentioning

confidence: 99%

“…In this regard, nucleic acid amplification tests, such as PCR, play an increasing role in the detection of BLV proviral DNA. Moreover, the use of quantitative real-time PCR (qPCR) assays has the added benefit of generating quantitative results (5)(6)(7). Considering that the BLV proviral load correlates directly with the risk of transmission (8,9), this feature of qPCR is important for developing rational segregation programs based on minimizing the risk of transmission.…”

mentioning

confidence: 99%

See 2 more Smart Citations

Interlaboratory Comparison of Six Real-Time PCR Assays for Detection of Bovine Leukemia Virus Proviral DNA

et al. 2018

View full text Add to dashboard Cite

Quantitative real-time PCR (qPCR) is increasingly being used for the detection of bovine leukemia virus (BLV) proviral DNA. Nevertheless, quality control for the validation and standardization of such tests is currently lacking. Therefore, the present study was initiated by three Office International des Epizooties (OIE) reference laboratories and three collaborating laboratories to measure the interlaboratory variability of six already developed and available BLV qPCR assays. For that purpose, an international panel of 58 DNA samples reflecting the dynamic range of the majority of the assays was distributed to six testing centers. Based on qualitative results, the overall agreement among all six laboratories was moderate. However, significant variability in the measurement of the BLV proviral DNA copy number was observed among different laboratories. Quantitative PCR assays, even when performed by experienced staff, can yield large variability in BLV proviral DNA copy numbers without harmonization. Further standardization of different factors (i.e., utilization of unified protocols and unique calibrators) should increase interlaboratory agreement.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Description Of Blv Qpcr Protocols Used By Participating Labomentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation

Interlaboratory Comparison of Six Real-Time PCR Assays for Detection of Bovine Leukemia Virus Proviral DNA

et al. 2018

View full text Add to dashboard Cite

show abstract

“…BLV qPCR was performed according to previously published methods [ 78 ]. Briefly, genomic DNA was amplified by TaqMan PCR with primers for pol gene (5′-CCTCAATTCCCTTTAAACTA-3′ and 5′-GTACCGGGAAGACTGGATTA-3′) and probe 6FAM GAACGCCTCCAGGCCCTTCABHQ1 in Rotor-Gene Q cycler using QuantiTect Multiplex PCR NoROX master mix (Qiagen AG GmbH, Germany) according to the protocol: 15 min denaturation at 95 °C followed by 45 cycles (60 s at 94 °C and 60 s at 60 °C).…”

Section: Methodsmentioning

confidence: 99%

Effects of Naturally Occurring Mutations in Bovine Leukemia Virus 5′-LTR and Tax Gene on Viral Transcriptional Activity

et al. 2020

Self Cite

View full text Add to dashboard Cite

Bovine leukemia virus (BLV) is a deltaretrovirus infecting bovine B cells and causing enzootic bovine leucosis (EBL). The long terminal repeat (LTR) plays an indispensable role in viral gene expression. The BLV Tax protein acts as the main transactivator of LTR-driven transcription of BLV viral genes. The aim of this study was to analyze mutations in the BLV LTR region and tax gene to determine their association with transcriptional activity. LTRs were obtained from one hundred and six BLV isolates and analyzed for their genetic variability. Fifteen variants were selected and characterized based on mutations in LTR regulatory elements, and further used for in vitro transcription assays. Reporter vectors containing the luciferase gene under the control of each variant BLV promoter sequence, in addition to variant Tax expression vectors, were constructed. Both types of plasmids were used for cotransfection of HeLa cells and the level of luciferase activity was measured as a proxy of transcriptional activity. Marked differences in LTR promoter activity and Tax transactivation activity were observed amongst BLV variants. These results demonstrate that mutations in both the BLV LTR and tax gene can affect the promoter activity, which may have important consequences on proviral load, viral fitness, and transmissibility in BLV-infected cattle.

show abstract

“…paratuberculosis IS900 AAGACCGACGCCAAAGACGCTGCGA CAGCGGCTGCTTTATATTCC 16 GCAGAGGCTGCAAGTCGT Clostridium perfringens Cpb AACGGATGCCTATTATCACCAACT ATTTCATTAGTTATAGTTAGTTCAC 10 TTATAGTAGTAGTTTTGCCTATATC Enterotoxigenic Escherichia coli K99 ATTTTAAACTAAAACCAGCGCCCGGCA GCTATTAGTGGTCATGGCACTGTAG 7 TTTGTTTTGGCTAGGCAGTCATTA Eimeria zuernii/bovis ITS1 TGGCCTGTTGTGGATAGTTACTG (zuernii) TGTCTAYACACACTMCATCCAAC This study GCCTTATGGATAGTTAGTGCTCC (bovis) CT GACCACAGTGTTGGAAATGC β-actin Actin TCGCTGTCCACCTTCCAGCAGATGT AGCGCAAGTACTCCGTGTG 28 CGGACTCATCGTACTCCTGCTT . Previously reported qPCR assays were used for 12 pathogen species, including RNA, DNA viruses and bacteria [ 7 , 8 , 10 , 13 , 15 , 16 , 17 , 22 , 23 , 28 , 29 ]. Furthermore, as an internal control within the Dembo-PCR reaction, primer-probe sets for β-actin were synthesized as previously reported [ 28 ].…”

Section: Methodsmentioning

confidence: 99%

Development of a novel detection system for microbes from bovine diarrhea by real-time PCR

Tsuchiaka

Masuda²,

Sugimura

et al. 2016

The Journal of Veterinary Medical Science

View full text Add to dashboard Cite

Diarrhea in cattle is one of the most economically costly disorders, decreasing milk production and weight gain. In the present study, we established a novel simultaneous detection system using TaqMan real-time PCR designed as a system for detection of microbes from bovine diarrhea using real-time PCR (referred to as Dembo-PCR). Dembo-PCR simultaneously detects a total of 19 diarrhea-causing pathogens, including viruses, bacteria and protozoa. Specific primer–probe sets were newly designed for 7 pathogens and were synthesized on the basis of previous reports for 12 pathogens. Assays were optimized to react under the same reaction conditions. The PCR efficiency and correlation coefficient (R2) of standard curves for each assay were more than 80% and 0.9766, respectively. Furthermore, the sensitivity of Dembo-PCR in fecal sample analysis was measured with feces spiked with target pathogens or synthesized DNA that included specific nucleotide target regions. The resulting limits of detection (LOD) for virus-spiked samples, bacteria and DNA fragments were 0.16–1.6 TCID50 (PFU/reaction), 1.3–13 CFU/reaction and 10–100 copies/reaction, respectively. All reactions showed high sensitivity in pathogen detection. A total of 8 fecal samples, collected from 6 diarrheic cattle, 1 diarrheic calf and 1 healthy cow, were tested using Dembo-PCR to validate the assay’s clinical performance. The results revealed that bovine coronavirus had infected all diarrheic adult cattle and that bovine torovirus had infected the diarrheic calf. These results suggest that Dembo-PCR may be a powerful tool for diagnosing infectious agents in cattle diarrhea.

show abstract

Development of an improved real time PCR for the detection of bovine leukaemia provirus nucleic acid and its use in the clarification of inconclusive serological test results

Cited by 26 publications

References 27 publications

Interlaboratory Comparison of Six Real-Time PCR Assays for Detection of Bovine Leukemia Virus Proviral DNA

Interlaboratory Comparison of Six Real-Time PCR Assays for Detection of Bovine Leukemia Virus Proviral DNA

Effects of Naturally Occurring Mutations in Bovine Leukemia Virus 5′-LTR and Tax Gene on Viral Transcriptional Activity

Development of a novel detection system for microbes from bovine diarrhea by real-time PCR

Contact Info

Product

Resources

About