Development of aLAC4 promoter-based gratuitous induction system inKluyveromyces lactis

Abstract

A gratuitous induction system based on the strong, indigenous LAC4 promoter was developed for Kluyveromyces lactis. To prevent consumption of the inducer galactose, a strain with a gal1‐209 mutation was employed; this mutation disables the galactokinase function but retains the regulatory function for induction. The Escherichia coli lacZ gene (encoding β‐galactosidase) is functional in K. lactis and was used as the reporter gene downstream of the LAC4 promoter on a multicopy plasmid. The gal1‐209 strain exhibited several unexpected phenomena, including partial consumption of the inducer galactose (although at a much slower rate relative to GAL1 strains) and growth inhibition at high concentrations of galactose. These unusual characteristics, however, did not prevent the successful construction of a strong gratuitous induction system. Due to the low rate of inducer consumption for the gratuitous strain, very low concentrations of galactose (1:20 galactose:glucose) resulted in high‐level induction. Under these conditions, β‐galactosidase specific and volumetric activities were 4.2‐ and 5.5‐fold higher, respectively, than those for the “GAL1” nongratuitous strain. This research demonstrated the improved productivity possible via LAC4 promoter‐based gratuitous induction (and thus a more stable inducer concentration). The effects of various carbon source concentrations on growth and induction were also determined. © 2000 John Wiley & Sons, Inc. Biotechnol Bioeng 67: 408–416, 2000.

Evaluation of the Saccharomyces cerevisiae ADH2 promoter for protein synthesis

“…The remaining Bam HI and Kas I ends were filled in and ligated to create the integrating vector pdδUBAlacZ (Figure 1A). A GAL1‐10 promoter fragment was synthesized by PCR using plasmid pRY121 (Yocum et al , 1984) without the 2µ element (Hsieh and DaSilva, 2000) as the template. Forward (5′‐CTGAATTCGCTCTACCACAGTGTGTGAA‐3′) and backward primers (5′‐AA‐GGATCCTCAGGTACAATCACTTCTTCTG‐3′) were designed such that the 800 bp PCR fragment was flanked by Bam HI and Eco RI.…”

Disruption of the OCH1 and MNN1 genes decrease N-glycosylation on glycoprotein expressed in Kluyveromyces lactis

“…The expression cassette for HSA/GM-CSF under the control of the LAC4 promoter was transformed to strains, and was purified using the 6× histidine tag to identify analysis of the released N-glycans and homogeneity of secreted glycoprotein in wild-type strain and mutants. The K. lactis integrative expression vector pKLAC1, which has been previously described (Bao et al, 1996;Colussi and Taron, 2005;Hsieh and Da, 2000;Read et al, 2007;van Ooyen et al, 2006), contains the Aspergillus nidulans acetamidase gene (amdS) that permits cell growth on medium containing acetamide.…”

Carbon source dependent promoters in yeasts

“…Significant applications consisted, for example, in the controlled expression of prochymosin, important in the context of cheese production [106], or in the expression of Rhizopus oryzae α-amylase [107]. The consumption of the inducer is a problem in practical applications of P LAC4 also in this organism: K. lactis strains with disrupted KlGAL1 were generated to prevent an early consumption of the inducer, following a similar strategy as the one showed for S. cerevisiae [108,109]. …”