Development of a set of multiplex standard polymerase chain reaction assays for the identification of infectious agents from aborted bovine clinical samples

Abstract

Abstract. The current study describes the development of a set of 5 multiplex polymerase chain reaction (mPCR) assays for the simultaneous detection of abortive infection agents in bovine fetal tissues, including Brucella spp., Leptospira spp., and Campylobacter fetus (mPCR1); Hammondia heydorni, Neospora caninum, and Toxoplasma gondii (mPCR2); Coxiella burnetii and Chlamydophila psittaci (mPCR3); Mycoplasma bovis, Mycoplasma bovigenitalium, and Ureaplasma diversum (mPCR4); and Bovine viral diarrhea virus (BVDV) and Bovine herpesvirus-1 (BoHV-1; mPCR5). The protocol was tested on different tissue samples collected from 50 aborted bovine fetuses, and it showed that out of the 50 fetuses, 7 (14%, mPCR2) were PCR-positive for N. caninum, 4 (8%, mPCR5) were PCR-positive for BVDV, and 2 (4%, mPCR4) were PCR-positive for U. diversum. The results obtained by using each multiplex PCR were 100% concordant with those obtained by using the respective PCR assays targeting single genes on the same specimens. Moreover, all multiplex PCR assays on clinical samples were compared with reference methods, obtaining a perfect accordance in all samples and confirming the validity of the set of multiplex PCR assays. The proposed set of multiplex PCR assays is, therefore, suitable for the simultaneous detection of the main infectious agents responsible for bovine abortion.

Determination of Neospora caninum and Toxoplasma gondii in aborted bovine foetuses by duplex PCR, immunohistochemistry and immunofluorescence methods

“…In addition, positive controls for N. caninum (ATCC Number: 50843D™ N. caninum Nc-1) and T. gondii (from the Refik Saydam Hıfzısıhha Centre) were used (47). The products obtained from a thermal cycler (Techne TC-PLUS) were run in a 1% agarose gel at 60-100 V for 90 minutes.…”

“…To detect the nucleic acids of the N. caninum and T. gondii in the DNA extracts, the primers of the related regions were chosen from those commonly used. For this purpose, the primer pairs that amplified a 337 bp long strand from the NC5 region for the N. caninum ([F] 5' CCCAGT-GCGTCCAATCCTGTAAC 3' and [R] 5' CTCGCCAGT-CAACCTACGTCTTCT 3') and primer pairs that amplified a 575 bp long strand from the ITS1 region for the T. gondii ([F] 5' TGGCGCCGTTCGTGCCCGAAAT 3' and [R] 5' TGCAITTYGCTGCGKYCTTC 3') were chosen (47).…”

Survey of Infectious Etiologies of Bovine Abortion during Mid- to Late Gestation in Dairy Herds

“…The latter represents the leading etiology of reproductive disorders [1], [2] A variety of infectious agents have been reported to cause bovine abortion throughout the world. The major bacterial agents that have been implicated in bovine abortion during mid- to late-gestation are Brucella spp., Chlamydia spp., Salmonella spp., Campylobacter spp., Listeria monocytogenes and Coxiella burnetii [3]–[5]. Bovine brucellosis was distributed worldwide, and its importance is related not only to the economic losses in animal production but also to a significant risk for human health.…”

A novel real-time PCR assay for quantitative detection of Campylobacter fetus based on ribosomal sequences

“…These methods are also laborious and time-consuming, a disadvantage when processing samples at large-scale or delivering a fast diagnosis. To improve the quality and complement the gold-standard bacteriological methods for C. fetu s detection, some end-point PCR methods have been designed based on the presence of species-specific amplicons [12, 27–29]; these assays fulfill various criteria such as accuracy, high detection probability and well-standardized protocols for its application and interpretation. Real-time PCR methods have been also designed with the same purpose [14–17] and have provided additional technical improvements to C. fetus detection protocols, like the prevention of cross contamination and the minimization of manipulation and running times.…”