Development of a Self-Inactivating Lentivirus Vector

Abstract

We have constructed a new series of lentivirus vectors based on human immunodeficiency virus type 1 (HIV-1) that can transduce nondividing cells. The U3 region of the 5′ long terminal repeat (LTR) in vector constructs was replaced with the cytomegalovirus (CMV) promoter, resulting in Tat-independent transcription but still maintaining high levels of expression. A self-inactivating (SIN) vector was constructed by deleting 133 bp in the U3 region of the 3′ LTR, including the TATA box and binding sites for transcription factors Sp1 and NF-κB. The deletion is transferred to the 5′ LTR after reverse transcription and integration in infected cells, resulting in the transcriptional inactivation of the LTR in the proviruses. SIN viruses can be generated with no significant decreases in titer. Injection of viruses into the rat brain showed that a SIN vector containing the green fluorescent protein gene under the control of the internal CMV promoter transduced neurons as efficiently as a wild-type vector. Interestingly, a wild-type vector without an internal promoter also successfully transduced neurons in the brain, indicating that the HIV-1 LTR promoter is transcriptionally active in neurons even in the absence of Tat. Furthermore, injection of viruses into the subretinal space of the rat eye showed that wild-type vector transduced predominantly retinal pigment epithelium and photoreceptor cells, while SIN vector was able to transduce other types of retinal cells, including bipolar, Müller, horizontal, and amacrine cells. This finding suggests that the HIV-1 LTR can negatively influence the internal CMV promoter in some cell types. SIN HIV vectors should be safer for gene therapy, and they also have broader applicability as a means of high-level gene transfer and expression in nondividing cells.

Exosomal vaccines containing the S protein of the SARS coronavirus induce high levels of neutralizing antibodies

“…The plasmids pLEGFP-N1 and pEGFP-C1 were purchased from Clontech, Heidelberg, Germany. The construction of the plasmids VCGΔBH SgpΔ2 (Schnell et al, 2000) Hgpsyn (Wagner et al, 2000), pHIT-G (Fouchier et al, 1997), HIV-CL-CG (Miyoshi et al, 1998), pcTatRev (Southgate et al, 1990, pCAGG-S and pCDNA-ACE/Z has been described. For the construction of the expression plasmids for the chimeric S proteins, the transmembrane and cytoplasmic domains (Chapple and Jones, 2002) of a codon-optimized version of the G protein of vesicular stomatitis virus were amplified from the plasmid pCD-Gsyn (unpublished data) using the primers 5′atttaaatgaatcactcattgaccttcaagaattgggaaaatatgagcaatatattaaatggcctttcggcgacaccggcctgagcaagaaccccatc and 5′ acaagctgctagccagccatagagcccaccgcatccccagcat, flanked with the restriction enzymes SwaI and NheI respectively.…”

Epigenetic deregulation of Ellis Van Creveld confers robust Hedgehog signaling in adult T‐cell leukemia

“…(5) Briefly, replication-defective, self-inactivating lentivirus vectors were used. (23,24) shRNA were cloned into a CS-H1-EVBsd. High-titer viral solutions prepared using a centrifugationbased concentration were transduced into ATL cell lines using the spinoculation method.…”

Jun Activation Domain-binding Protein 1 (JAB1) Is Required for the Optimal Response to Interferons

“…Lentiviral GFP Transduction of HeLa Cells-The HIV-1based lentiviral vector pseudotyped with the vesicular stomatitis virus G glycoprotein (31) was generated according to previously described procedures (32) with some modification. In brief, 293T cells were transiently co-transfected with appropriate amounts of the self-inactivating lentiviral vector pCSII-CMV-MCS-IRES-hrGFP, the packaging construct (pMDLg/ pRRE), the Rev-expressing construct (pRSV-Rev), and the vesicular stomatitis virus G glycoprotein-expressing construct (pMD.G).…”

“…These results suggest that inhibition of the neddylation pathway can augment STAT1 activation effects of IFN-␣ by stabilizing the IFNAR1 protein level. We further examined effects of NAE inhibitor on IFN-␣-induced antiviral effects in HeLa cells by using a pseudo-type lentiviral infection system (31). As shown in Fig.…”