Development of a scar marker for the Ph1 Locus in common wheat and its application

Abstract

To facilitate wheat breeding with the Ph1 gene, 19 sequence tagged‐polymerase chain reaction (STS‐PCR) primers developed previously from barley chromosome 5H were screened. One pair of STS‐PCR primers differentiated ‘Chinese Spring’ (CS, Ph1) and the CS mutant (ph1b). The diagnostic fragment was 920 base pairs (bp) in size, designated as ABC920, and was located on the interstitial deletion of the long arm of chromosome 5B of ph1b mutant. Plants with or without the Ph1 gene could be distinguished among 148 F2 / 97 BC1 plants from the cross CS (Ph1) × CS mutant (ph1b) on the basis of the presence or absence of this fragment. Subsequently, two 24‐mer sequence characterized amplified regions (SCAR) primers were developed on the basis of sequences at both ends of the ABC920 fragment to generate a single amplified band in plants with the Ph1 genotype. The Ph1 and ph1b genotypes can be readily scored in the PCR products of individual plant DNA. This SCAR marker (SCABC823) was used to facilitate the transfer of the ph1b locus into an elite wheat (Triticum aestivum L.) cultivar. This marker is expected to aid in gene transfer between wheat and its wild relatives.

Dynamics of DNA Replication during Premeiosis and Early Meiosis in Wheat

“…DNA from wheat lines either in the presence or in the absence of the Ph1 locus were extracted from young frozen leaf tissue using the CTAB method [39] with some modifications [40] . CS and CS ph1 mutants were checked for the ph1 deletion using the ABC 920 SCAR marker as described previously [41] .…”

Registration of a Hard Red Winter Wheat Genetic Stock Homozygous for ph1b for Facilitating Alien Introgression for Crop Improvement

“…Two PCR‐based markers, WGP90 and PSR2120, were used to detect the homozygous ph1b mutant in the first two generations of F 2 and BC 1 F 2 . In BC 2 F 2 , we used a pair of barley chromosome 5H‐specific STS‐PCR primers ABC302.3, (forward primer: 5′‐ATAAAGGAGAAGATTGAGTC‐3′; reverse primer: 5′‐ATAAGGAACAGGAACAGAGT‐3′) to identify plants that were homozygous for ph1b (Blake et al, 1996; Wang et al, 2002). The primers amplify two fragments in CS.…”

“…The primers amplify two fragments in CS. The top fragment is 5B specific and bottom one is 5A specific (Wang et al, 2002). The top fragment of about 920 bp (designated as ABC 920 ) is the Ph1 ‐specific band that is absent in the CS ph1b mutant stock TA3809 and 5BL deletion stocks, but the 5A‐specific fragment is present in both lines (Fig.…”

Utilizing single primers as molecular markers inPoaspp.

“…The non‐SSR primers, not including RAPD primers, ranged 10–29 nt in length and represent an array of various types: (i) sequence characterized amplified repeat (SCAR) markers that were generated from randomly generated RAPD products (Hernandez et al. 1999); (ii) SCAR markers generated from RAPD markers having an association to a particular gene locus (Wang et al. 2002); (iii) amplified fragment length polymorphism (AFLP) markers converted to sequence‐specific PCR markers (Shan et al.…”

“…The species from which 63 non-SSR primers were obtained were selected entirely at random and were generated by various research units to amplify genomic regions having consequence for marker-to-trait associations in Triticum aestivum L., Hordeum vulgare L. and Lolium perenne L. genetic programs (Table 1). The non-SSR primers, not including RAPD primers, ranged 10-29 nt in length and represent an array of various types: (i) sequence characterized amplified repeat (SCAR) markers that were generated from randomly generated RAPD products (Hernandez et al 1999); (ii) SCAR markers generated from RAPD markers having an association to a particular gene locus (Wang et al 2002); (iii) amplified fragment length polymorphism (AFLP) markers converted to sequence-specific PCR markers (Shan et al 1999); and (iv) sequence tagged site (STS) markers converted from restriction fragment length poly-morphism (RFLP) clones (Sayed-Tabatabaei et al 1998). A total of 280 RAPD primers were obtained from both the University of British Columbia UBC1-200 and Operon Technologies OP Kits A, B, C and D. Sequences of the RAPD primers can be found by contacting the University of British Columbia Nucleic Acid-Protein Service Unit or Operon Technologies.…”