Development of a novel method for rapid cloning of shRNA vectors, which successfully knocked down CD44 in mesenchymal triple‐negative breast cancer cells

Sheng, Dandan; Deng, Qiaodan; Wang, Dong; Liu, Su-Ling

doi:10.1186/s40880-018-0327-7

Cited by 8 publications

(8 citation statements)

References 11 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Single tumor cell aggregated, which enabled cluster formation and colonization of clustered tumor cells and contributed to tumor metastasis and secondary tumor formation in TNBC [30]. In mesenchymal TNBC which is a subcategory of TNBC and is featured with high rates of invasion and metastasis according to Lehmann BD' work [57,114], stable deletion of CD44 with shRNA vectors restrained proliferation, colony formation and invasion of SUM159, MDA-MB-436 and MDA-MB-231 [115].…”

Section: Cd44 and Tumor Developmentmentioning

confidence: 99%

CD44 as a tumor biomarker and therapeutic target

et al. 2020

View full text Add to dashboard Cite

CD44, a complex transmembrane glycoprotein, exists in multiple molecular forms, including the standard isoform CD44s and CD44 variant isoforms. CD44 participates in multiple physiological processes, and aberrant expression and dysregulation of CD44 contribute to tumor initiation and progression. CD44 represents a common biomarker of cancer stem cells, and promotes epithelial-mesenchymal transition. CD44 is involved in the regulation of diverse vital signaling pathways that modulate cancer proliferation, invasion, metastasis and therapy-resistance, and it is also modulated by a variety of molecules in cancer cells. In addition, CD44 can serve as an adverse prognostic marker among cancer population. The pleiotropic roles of CD44 in carcinoma potentially offering new molecular target for therapeutic intervention. Preclinical and clinical trials for evaluating the pharmacokinetics, efficacy and drug-related toxicity of CD44 monoclonal antibody have been carried out among tumors with CD44 expression. In this review, we focus on current data relevant to CD44, and outline CD44 structure, the regulation of CD44, functional properties of CD44 in carcinogenesis and cancer progression as well as the potential CD44-targeting therapy for cancer management.

show abstract

Section: Cd44 and Tumor Developmentmentioning

confidence: 99%

CD44 as a tumor biomarker and therapeutic target

et al. 2020

View full text Add to dashboard Cite

show abstract

“…PSMG3‐AS1 overexpression plasmid used in this study was purchased from GenePharma (Shanghai, China). PSMG3‐AS1‐specific shRNA vector and nontargeting control (NC) were constructed following the previously reported rapid shRNA cloning method (Zhou et al., 2018) using the following shRNA sequence (5′‐AGTTCAGAATGGGAGACGTCC‐3′) to specifically knock down PSMG3‐AS1, and a nontargeting shRNA (5′‐ TTGGTGCTCTTCATCTTGTTG‐3′) (Zhou et al., 2019) as control.…”

Section: Methodsmentioning

confidence: 99%

PSMG3‐AS1 enhances glioma resistance to temozolomide via stabilizing c‐Myc in the nucleus

et al. 2022

View full text Add to dashboard Cite

Glioblastoma (GBM) is the main form of primary brain malignancies with a dismal prognosis partly due to its invasive growth and rapid relapse. GBM frequently developed resistance to current standard‐of‐care therapeutic modalities, including surgery, radiation and chemotherapy, of which temozolomide (TMZ) is the most widely used first‐line anti‐GBM drug. Despite the intense efforts of the past decades, the underlying mechanisms of GBM resistance to TMZ remain largely unclear. Here we show that the long noncoding RNA (lncRNA) PSMG3‐AS1 is significantly upregulated in GBM and its expression correlates with the grade of glioma, with the highest level observed in GBM (Grade IV glioma). We also demonstrated that PSMG3‐AS1 mediates the resistance of GBM to TMZ, as knockdown of PSMG3‐AS1 remarkably increased the sensitivity whereas overexpression of PSMG3‐AS1 in sensitive GBM cell line induced a resistance phenotype to TMZ. Mechanistically, PSMG3‐AS1 directly binds to c‐Myc and thus stabilizes c‐Myc in the nucleus to promote the survival of GBM cells under treatment of TMZ. Our data demonstrated an unreported role of PSMG3‐AS1 in TMZ resistance and provide a potential novel target to tackle TMZ resistance in GBM.

show abstract

“…The shRNA vectors targeting LINC02273 used in this study were cloned following a previously reported method [ 18 ], with two independent target sites to exclude off-target effects: 5′- GTGGGAAGACCTATTATAAGT -3′ (KD-1) and 5′- CTCTCCAAGGTGCCAGGGTTA -3′ (KD-2) and a scramble sequence (5′- CCTAAGGTTAAGTCGCCCTCG -3′) targeting as the control. All plasmids were verified by sequencing at Sangon Biotechnology (Shanghai, China).…”

Section: Methodsmentioning

confidence: 99%

“…All plasmids were verified by sequencing at Sangon Biotechnology (Shanghai, China). Lentivirus particles were packaged and used as previously described [ 18 ]. Briefly, lentivirus was produced by cotransfecting HEK293T cells with desired plasmids together with psPAX2 and pMD2.G.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

LINC02273 Promotes Hepatocellular Carcinoma Progression via Retaining β-Catenin in the Nucleus to Augment Wnt Signaling

Liang

Zhu

et al. 2022

BioMed Research International

View full text Add to dashboard Cite

Hepatocellular carcinoma (HCC) is a lethal malignancy whereas the molecular mechanisms remain poorly understood. Recently, long noncoding RNAs (lncRNA) have been shown to regulate HCC progression. However, the involved lncRNAs remain to be fully explored. Here, we showed the expression pattern and biological function of a recently identified lncRNA, LINC02273, in HCC. LINC02273 played a critical role in HCC progression via stabilizing β-catenin. Knockdown of LINC02237 remarkably inhibited the proliferation, stemness, migration, and invasion abilities, whereas it increased the apoptosis of HCC cells. Overall, we characterized the functions of LINC02273 in HCC and its potential as a novel HCC targeting candidate.

show abstract

Development of a novel method for rapid cloning of shRNA vectors, which successfully knocked down CD44 in mesenchymal triple‐negative breast cancer cells

Cited by 8 publications

References 11 publications

CD44 as a tumor biomarker and therapeutic target

CD44 as a tumor biomarker and therapeutic target

PSMG3‐AS1 enhances glioma resistance to temozolomide via stabilizing c‐Myc in the nucleus

LINC02273 Promotes Hepatocellular Carcinoma Progression via Retaining β-Catenin in the Nucleus to Augment Wnt Signaling

Contact Info

Product

Resources

About