Development of a highly sensitive assay, based on the polymerase chain reaction, for rare B‐lymphocyte clones in a polyclonal population

Abstract

A method has been developed to use the polymerase chain reaction to amplify and sequence the chain determining region 3 (CDR 3) of the human immunoglobulin heavy-chain gene, and to use the sequence as a marker for rare neoplastic B lymphocytes. Consensus primers for the Variable and Joining regions of the gene were constructed and shown to enable efficient amplification, directed cloning, and sequencing of CDR 3. Using leukaemic cell line PFMC as a test system, CDR 3 was sequenced, specific primers synthesized, and PFMC DNA was detected down to a dilution of 1:1300 in DNA from normal lymphocytes. This strategy should be useful for monitoring therapy and detecting early disease relapse in B lymphoproliferative disease.

Culture system for extensive production of CD19+IgM+ cells by human cord blood CD34+ progenitors

“…cell population will be characterized by amplified DNA of a single size, while a polyclonal B cell population will be characterized by amplified DNA of a range of sizes. 23,24 As shown in Figure 7, the broad smear of polyclonal amplified DNA was observed in PBMC (lane 1), whereas a discrete amplified band approximately 100 bp in length was seen in a monoclonal population of the B-lymphoid cell line Raji (lane 2). Two cases of nonadherent cells harvested after 4 weeks of co-culture (lanes 3 and 4) generated a diffuse smear of amplified DNA, indicating that the polyclonal rearrangement of immunoglobulin-chain gene was carried out.…”

“…23,24 For the first round of amplification, the framework 3 consensus primer (5′-ACACGGC[C/T][G/C]TGTATTACTGT-3′) and a downstream consensus primer directed at the joining region (LJH: 5′-TGAGGAGACGGTGACC-3′) were used. For the second round of PCR, the Fr3 primer was used in conjunction with an inner downstream primer (VLJH: 5′-GTGAC-CAGGGTNCCTTGGCCCCAG-3′).…”

Large cell lymphoma complicating persistent polyclonal B cell lymphocytosis

“…Evaluation of clonality was assessed by PCR analysis of the chain determining region 3 (CDR3) of the human Ig heavy chain gene according to a modified technique described by Brisco et al 22 After RNA extraction and reverse transcription of either Raji cells (ATCC, Rockville, MD, USA), lymphoma cells or PBMC from normal subjects, cDNA was amplified with the FR3A primer 5ЈACACGGC(C/T)(G/C)TGTATTA-CTGT3Ј and the Ig VLJH primer 5ЈGTGACCAGGGT/ NCCTTGGCCCCAG3Ј for 40 cycles. RNA extraction quality control was assessed using glucose 3-phosphate dehydrogenase (G3PDH) primers 5ЈTGAAGGTCGGAGTCAACGGA-TTTGGT3Ј and 5ЈCATGTGGGCCATGAGGTCCACCAC3Ј with the same amplification conditions.…”

Use of rituximab and irradiated donor-derived lymphocytes to control Epstein–Barr virus-associated lymphoproliferation in patients undergoing related haplo-identical stem cell transplantation

“…Cell aliquots of 1 ϫ 10 6 were amplified using primers (operons) for the EBV BMLF 1 gene. 16 The 50 l PCR reaction components were supplied by Roche Molecular Biochemicals and included 10ϫ PCR buffer, 1.5 mm MgCl 2 , 0.025 m each of dATP, dCTP, dGTP and dUTP, and 1.0 units of Taq DNA polymerase.…”

“…The PCR product was hybridized to a probe (10 pm) labeled with the tris (2,2Ј-bipyridine) rutherium II chelate (TBR) electrochemiluminescent label (Baron Biotech, Milford, CT, USA). 16 The hybridized PCR product was quantified using a Perkin-Elmer QPCR 5000. All patient samples were amplified using ␤-globin primers to test for DNA integrity.…”