Development of a cell‐free system reveals an oxygen‐labile step in the maturation of [NiFe]‐hydrogenase 2 of Escherichia coli

Abstract

a b s t r a c tBy combining extracts from strains lacking genes encoding either the maturation enzymes or the large subunits of hydrogenases 1, 2 and 3 we could reconstitute in vitro under strictly anaerobic conditions 10-15% of the hydrogenase activity present in wild type Escherichia coli extracts. Purified, unprocessed Strep-tagged variants of the hydrogenase 2 large subunit, HybC, isolated from either a DhybD (encoding the hydrogenase 2-specific protease) mutant or a strain deficient in HypF could also be matured to active, processed enzyme using this system. These studies reveal that minimally one step early on the hydrogenase maturation pathway is oxygen-labile.

Probing the Origin of the Metabolic Precursor of the CO Ligand in the Catalytic Center of [NiFe] Hydrogenase

“…Although all three glycerolderived carbons occur as CO ligands, the terminal carbon atoms appear to be preferentially incorporated into the cofactor. This observation is supported by a control experiment using [2][3][4][5][6][7][8][9][10][11][12][13] C]glycerol as the substrate (supplemental Fig. S1).…”

“…In contrast to iron-only hydrogenases, which are assembled under completely anaerobic conditions (3,5,6), a number of [NiFe] hydrogenases is synthesized and catalytically active under aerobic conditions (7)(8)(9). Hence, biosynthesis of the metal cofactors needs to be protected against detrimental effects of oxygen.…”

“…[NiFe] hydrogenase maturation proceeds via entirely different and considerably more complex routes than that of [FeFe] hydrogenases (3,9,10). This is partly due to the fact that the active site contains two different metals.…”

Efficient electron transfer from hydrogen to benzyl viologen by the [NiFe]-hydrogenases of Escherichia coli is dependent on the coexpression of the iron–sulfur cluster-containing small subunit

“…(5 0 -ATGGTAGGTCTCATATCAACG CACCTGCACGGAGATCAG-3 0 ), hycE-IBA5_BsaI_FW (5 0 -ATGGTAGGTCTCAGCGCCATGTCTGAAGAAAA ATTAGGTCAACA-3 0 ) and hycE-IBA5_BsaI_RW (5 0 -A TGGTAGGTCTCATATCATTTCAGCGGCGAGTTTTT ACGCT-3 0 ), as well as those published in (Soboh et al 2010) for hybC (hybC-IBA5_BsaI_FW, and hybCIBA5_BsaI_RW). The resulting DNA fragments of 1,794 bp (hyaB), 1,704 bp (hybC), and 1,710 bp (hycE) were digested with restriction endonuclease BsaI and ligated into pASK-IBA5 ?…”

“…The matrix was equilibrated with 100 mM Tris-HCl, pH 8.0 containing 150 mM NaCl (buffer A). The crude extracts were incubated with avidin (80 lg ml -1 of crude extract) for 45 min at 4°C, and then, membrane fractions were prepared by anaerobic ultracentrifugation at 120,0009g for 2 h as previously described (Soboh et al 2010). The soluble fractions were decanted and stored for later use, and the membranes were resuspended in buffer A, and Triton X-100 was added to a final concentration of 5% (w/v), and the solution was gently stirred overnight at 4°C.…”