Development of a 16S rRNA gene-based prototype microarray for the detection of selected actinomycetes genera

Abstract

Actinomycetes are known for their secondary metabolites, which have been successfully used as drugs in human and veterinary medicines. However, information on the distribution of this group of Gram-positive bacteria in diverse ecosystems and a comprehension of their activities in ecosystem processes are still scarce. We have developed a 16S rRNA-based taxonomic microarray that targets key actinomycetes at the genus level. In total, 113 actinomycete 16S rRNA probes, corresponding to 55 of the 202 described genera, were designed. The microarray accuracy was evaluated by comparing signal intensities with probe/target-weighted mismatch values and the Gibbs energy of the probe/target duplex formation by hybridizing 17 non-actinomycete and 29 actinomycete strains/clones with the probe set. The validation proved that the probe set was specific, with only 1.3% of false results. The incomplete coverage of actinomycetes by a genus-specific probe was caused by the limited number of 16S rRNA gene sequences in databases or insufficient 16S rRNA gene polymorphism. The microarray enabled discrimination between actinomycete communities from three forest soil samples collected at one site. Cloning and sequencing of 16S rRNA genes from one of the soil samples confirmed the microarray results. We propose that this newly constructed microarray will be a valuable tool for genus-level comparisons of actinomycete communities in various ecological conditions.

Bacterial diversity and abundance of a creek valley sites reflected soil pH and season

“…For cloning, a non-labelled 27f forward primer combined with PH reverse primer (AAGGAGGTGATCCAGCCGCA); [28] for bacteria and act1114r (GAGTTGACCCCGGCRGT); [29] for actinobacteria were used.…”

“…From winter sampling, 48 bacterial clones (GenBank Accession Numbers GU194183 to GU194230) and 59 actinobacterial clones (GenBank Accession Numbers GU194231 to GU194289) were sequenced and analyzed. From summer, 56 bacterial clones (not yet presented in full but commented in [29]; GenBank Accession Numbers EU715822 to EU715877) and 79 actinobacterial clones previously published [29]; GenBank Accession Numbers EU715878 to EU715976) were used for the analyses.…”

Development of a prototype 16S rRNA gene-based microarray for monitoring planktonic actinobacteria in shrimp ponds

“…The melting temperature was between 72.8 and 83.3°C (90% of probes fell within the 80 ± 5°C temperature ranges; Table 2). As hybridizations can occur even in case of non-perfect matches (Kyselková et al 2008;Loy et al 2002), the specificity of probes was assessed using both Probe Match and BLAST.…”

Modification of the terminal restriction fragment length polymorphism analysisfor assessment of a specific taxonomic group within a soil microbial community

“…HEx, FaM) were cleaved with a site-specific restriction endonuclease to obtain genetic fingerprints of bacterial communities. in short for an example of eubacterial-actinomycete profile: purified PCr products from the 16S rDna region using primers 16Seu27f-HEx and 16Seu783r (Sakai et al 2004) for the eubacterial amplicon and purified PCr products of the 16S rDna region amplified by the same universal forward primer 16Seu27f but labeled with FaM and actinomycete specific reverse primer 1114act (Kyselková et al 2008) are mixed in a ratio 2:1. always, the common primer must be labeled by a different color for each of the two or more specific taxonomic groups assessed. the total amount of PCr products in the mixture should be at least 200 μg and the same in all samples.…”

“…reSultS ANd diScuSSioN the method of double color t-rFlP was tested in a simultaneous profiling of the whole bacterial ( Figure 1a) and particular actinobacterial ( Figure 1B) communities in a deciduous forest soil in Srbsko in the Czech Karst (Čermák et al , Kyselková et al 2008. in bacterial and actinobacterial profiles, 39 and 31 peaks were detected, respectively.…”