Development and bin mapping of gene-associated interspecific SNPs for cotton (Gossypium hirsutum L.) introgression breeding efforts

Abstract

BackgroundCotton (Gossypium spp.) is the largest producer of natural fibers for textile and is an important crop worldwide. Crop production is comprised primarily of G. hirsutum L., an allotetraploid. However, elite cultivars express very small amounts of variation due to the species monophyletic origin, domestication and further bottlenecks due to selection. Conversely, wild cotton species harbor extensive genetic diversity of prospective utility to improve many beneficial agronomic traits, fiber characteristics, and resistance to disease and drought. Introgression of traits from wild species can provide a natural way to incorporate advantageous traits through breeding to generate higher-producing cotton cultivars and more sustainable production systems. Interspecific introgression efforts by conventional methods are very time-consuming and costly, but can be expedited using marker-assisted selection.ResultsUsing transcriptome sequencing we have developed the first gene-associated single nucleotide polymorphism (SNP) markers for wild cotton species G. tomentosum, G. mustelinum, G. armourianum and G. longicalyx. Markers were also developed for a secondary cultivated species G. barbadense cv. 3–79. A total of 62,832 non-redundant SNP markers were developed from the five wild species which can be utilized for interspecific germplasm introgression into cultivated G. hirsutum and are directly associated with genes. Over 500 of the G. barbadense markers have been validated by whole-genome radiation hybrid mapping. Overall 1,060 SNPs from the five different species have been screened and shown to produce acceptable genotyping assays.ConclusionsThis large set of 62,832 SNPs relative to cultivated G. hirsutum will allow for the first high-density mapping of genes from five wild species that affect traits of interest, including beneficial agronomic and fiber characteristics. Upon mapping, the markers can be utilized for marker-assisted introgression of new germplasm into cultivated cotton and in subsequent breeding of agronomically adapted types, including cultivar development.Electronic supplementary materialThe online version of this article (doi:10.1186/1471-2164-15-945) contains supplementary material, which is available to authorized users.

Uncovering SNP and indel variations of tetraploid cottons by SLAF-seq

“…To date, SNP discoveries have been applied in other crops beyond cotton [16]. SNP discoveries in cotton have progressed using different methods, such as BAC-end sequences [16], single copy sequences [17], transcriptome sequencing [18], reduced representation libraries (RRL) techniques [19]. Nevertheless, based on these techniques, access to information on SNPs is still very limited.…”

Non-destructive high-throughput DNA extraction and genotyping methods for cotton seeds and seedlings

“…The SNPs were chosen from subsets of large numbers of interspecific SNPs identified by comparative RNA-Seq analysis and experimentally tested using KASP assays (LGC Genomics, Beverly, MA) as part of the computational pipeline evaluation process for identifying putative SNPs between cotton ( G. hirsutum ) and several related 52- and 26-chromosome species (19). SNP Gl_072641 can be detected by KASP assays using the common reverse primer TGTGGAGGCATAGTGAGAGG and forward SNP-specific primers GGTGTATGTAAAAGTCCGAAAGCA and GTGTATGTAAAAGTCCGAAAGCG.…”

Recent Developments in Fiber Genomics of Tetraploid Cotton Species

“…armourianum, and G. longicalyx) and two cultivated cotton species (G. barbadense and G. hirsutum) [35]. By combining RNA-Seq and super bulked segregant analysis sequencing (sBSAseq) approaches, Li 2 mutant and its wild-type near-isogenic line (NIL) G. hirsutum cv.…”