Detection of uncoupled circadian rhythms in individual cells ofLemna minorusing a dual-color bioluminescence monitoring system

Abstract

<jats:title>Summary</jats:title><jats:p>The plant circadian oscillation system is based on the circadian clock of individual cells and coordinates the circadian behavior of the plant body. To observe the cellular circadian behavior of both the oscillator and its output in plants, we developed the dual-color bioluminescence monitoring system that automatically measured the luminescence of two luciferase reporters simultaneously at a single-cell level. We selected a yellow-green-emitting firefly luciferase (LUC+) and a red-emitting luciferase (PtRLUC) that is a mutant form of Brazilian click beetle ELUC. We used <jats:italic>AtCCA1::LUC</jats:italic>+ and <jats:italic>CaMV35S::PtRLUC</jats:italic> to observe the cellular behavior of the oscillator and output, respectively. These bioluminescent reporters were introduced into the cells of a duckweed, <jats:italic>Lemna minor</jats:italic>, by particle bombardment. Time series of the bioluminescence of individual cells in a frond were obtained using a dual-color bioluminescence monitoring system with a green-pass- and red-pass filter. Luminescence intensities from the LUC+ and PtRLUC of each cell were calculated from the filtered luminescence intensities. We succeeded in reconstructing the bioluminescence behaviors of <jats:italic>AtCCA1::LUC</jats:italic>+ and <jats:italic>CaMV35S::PtRLUC</jats:italic> in the same cells. Under prolonged constant light conditions, <jats:italic>AtCCA1::LUC</jats:italic>+ showed a robust circadian rhythm in individual cells in an asynchronous state in the frond, as previously reported in studies using other plants. In contrast, <jats:italic>CaMV35S::PtRLUC</jats:italic> stochastically showed circadian rhythms in a synchronous state. Thus, we clearly demonstrated the uncoupling between the oscillator and output in individual cells. This dual-color bioluminescence monitoring system is a powerful tool to analyze various stochastic phenomena accompanying large cell-to-cell variation in gene expression.</jats:p><jats:sec><jats:title>Significance statement</jats:title><jats:p>We succeeded in establishing the world’s first dual-color bioluminescence monitoring system at a single-cell level that enables simultaneous measurement of the luminescence activities of two reporter genes in plants. This system is a strong tool to analyze stochastic phenomena, and we clearly demonstrated the uncoupling of rhythmic behavior between two bioluminescent reporters in individual cells that stochastically occurred in the same plant.</jats:p></jats:sec>

No circadian clock-gene circuit in the generation of cellular bioluminescence rhythm of CaMV35S::PtRLUC in duckweed

“…The period difference between AtCCA1::LUC+ and CaMV35S::PtRLUC bioluminescence rhythms in the same cell In order to directly compare circadian properties of the bioluminescence rhythms between the two reporters, we performed dual-color bioluminescence monitoring at a single-cell level. 12 Circadian reporters with different luminescence colors, AtCCA1::LUC+ (yellow-green) and CaMV35S::PtRLUC (red), were introduced into L. minor cells (epidermal and mesophyll cells) through particle bombardment (Figure 1A). The bioluminescence of individual cells was observed using an EM-CCD camera with a filter exchanger containing green-pass and red-pass filters, and the cellular luminescence intensities of each reporter were reconstructed based on a set of filtered luminescence images (Figure 1B).…”

An endogenous basis for synchronisation characteristics of the circadian rhythm in proliferating Lemna minor plants

“…Cellular circadian rhythms linked to generation or uptake of these molecules are an interesting target to understand the synchronisation phenomena, while spatial patterns of CaMV35S:luciferase bioluminescence rhythm (i.e. possible substrate rhythm) have not been observed in frond (Watanabe et al ., 2021). Such intracellular and intercellular circadian physiology may be involved in the local coupling.…”

“…Because circadian mediators that transmit the plasmodesmata, ions such as Ca 2+ , low‐molecular‐weight metabolites, and clock‐related proteins such as ELF4 may have functions in local coupling (Johnson et al ., 1995; Haydon et al ., 2013; Martí Ruiz et al ., 2018; Chen et al ., 2020). In the duckweed plant, the uncoupling between two bioluminescence circadian rhythms ( AtCCA1:LUC and CaMV35S:luciferase ) in the same cells was reported; the CaMV35S:luciferase rhythmicity was associated with the synchronous state of the plant body (Watanabe et al ., 2021). The low‐amplitude bioluminescence rhythm of the luciferase reporter driven by a constitutive promoter implied the presence of circadian rhythm of intracellular concentrations of enzyme substrates such as ATP, oxygen and luciferin.…”

Interspecific divergence of circadian properties in duckweed plants

“…We used pUC‐AtCCA1::intron‐LUC+:NosT ( AtCCA1::LUC+ ) (Watanabe et al, 2021) and pUC18 pAtCCR2:intron‐LUC+:NosT (AtCCR2::LUC+) as circadian bioluminescent reporters. The promoter region of the Arabidopsis CCR2 gene was amplified by polymerase chain reaction (PCR) with the genomic DNA template ( A. thaliana Col‐0) and the primers (5′‐TGGATCCACCGTGTGAGTTGGTAGCG‐3′ and 5′‐AGGCGCGCCTGAAATTTGAAAAGAAGATCTAAG‐3′) (Strayer et al, 2000).…”