Detection of the GSTM1*0 allele by long polymerase chain reaction

Kerb, Reinhold; Brockmöller, Jürgen; Sachse, Christoph; Roots, Ivar

doi:10.1097/00008571-199902000-00012

Cited by 19 publications

(11 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Second, the majority of studies compared complete absence of GSTM1 with carriers of one or two copies of the gene that can be analysed by straightforward genotyping techniques [27,28]. It is, however, possible to determine the number of GSTM1 and GSTT1 alleles [29,30] and there is evidence that GSTT1 allele number is an important modifier of cancer risk as opposed to a simplified comparison between absence and presence of this gene [30]. In our present study, we have therefore used a method to determine the number of GSTM1 alleles.…”

Section: Discussionmentioning

confidence: 99%

Glutathione S-transferase variants and hypertension

Delles

Padmanabhan²,

Lee³

et al. 2008

Journal of Hypertension

View full text Add to dashboard Cite

show abstract

Section: Discussionmentioning

confidence: 99%

Glutathione S-transferase variants and hypertension

Delles

Padmanabhan²,

Lee³

et al. 2008

Journal of Hypertension

View full text Add to dashboard Cite

show abstract

“…Previously developed assays testing the trimodal phenotype pattern only tested for one gene at a time. 2,15 To our knowledge, these assays have only been used in small-scale studies probably because of the amount of work involved in the genotyping. Recently, multiplex realtime quantitative PCR-based assays for quantification of GSTM1 and GSTT1 gene copy numbers based on the TaqMan platform were developed allowing typing of one gene at a time.…”

Section: Discussionmentioning

confidence: 99%

Multiplex PCR Detection of GSTM1, GSTT1, and GSTP1 Gene Variants

Buchard

Sánchez

Dalhoff

et al. 2007

The Journal of Molecular Diagnostics

View full text Add to dashboard Cite

The glutathione S-transferase (GST) genes GSTM1, GSTT1, and GSTP1 are involved in the detoxification of a broad range of toxic substances. Genetic polymorphisms in these genes have been studied intensively for their potential role in cancer susceptibility and drug response. In Caucasians, the enzyme activity of GSTM1 and GSTT1 is absent in approximately 50 and 15% of the population, respectively, due to deletions of both chromosomal copies of the genes. A trimodal phenotype pattern exists in which individuals with two, one, or no functional genes are fast, intermediate, or slow "conjugators," respectively. Most studies investigating the effect of the GSTM1 and GSTT1 deletions do not distinguish between fast and intermediate conjugators because the applied genotyping assays only detect if at least one copy of either gene is present. We present a multiplex PCR assay that detects if an individual has none, one, or two copies of the GSTM1 and GSTT1 genes and simultaneously detects the allelic status of the GSTP1 Ile105Val genetic variant. A total of 200 Danes, 100 Somalis, and 100 Greenlanders were genotyped. This multiplex PCR assay enables future large-scale studies to investigate the role of GSTs. (J Mol Diagn

show abstract

“…The GSTM1*0 allele was identified by presence of a deletion specific amplicon (20). PCR with the primers ACAGAGGAAGGGTGCATTTGATA (forward) and GA-CATTCATTCCCAAAGCGACCA (reverse) yields a GSTM1*0 specific amplicon of 4742 bp size.…”

Section: Methodsmentioning

confidence: 99%