Detection of porcine-derived ingredients from adulterated meat based on real-time loop-mediated isothermal amplification

Cai, Shaoxin; FanDe, Kong; Xu, Shufei

doi:10.1016/j.mcp.2020.101609

Cited by 18 publications

(7 citation statements)

References 35 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The primer design of primers refer to the procedure carried out by Cai et al (2020) designing Bos taurus primer using a template with an accession number AF492351. The obtained primers were forward: 5'-ACTAGCCCTAGCCTTCTCTATC-3' and reverse: 5'-TGTCAGTAGGTCTGCTACTAGG-3'.…”

Section: Resultsmentioning

confidence: 99%

The Employment of Real-Time Polymerase Chain Reaction for the Identification of Bovine Gelatin in Gummy Candy

et al. 2022

View full text Add to dashboard Cite

Gelatin is a hydrocolloid widely used in food products, especially soft candy. It contains essential amino acids - except tryptophan - which is easily digested, not toxic, can form a flexible and robust film layer to produce the right product. However, as a Muslim, it must ensure that what is consumed is halal, from bovine gelatin. The purpose of this study was to identify bovine gelatin in soft candy products using specific primers with real-time PCR methods. The specific DNA primer design is done with PRIMERQUEST and NCBI software and subjected to primer-basic local alignment search tool (BLAST). Analysis for the primer specificity was performed on fresh tissue (cows, pigs, dogs, chickens, goats, and rats) and gelatin sources (beef and pork). RT-PCR method using primer mitochondrial Cytochrome B gene was applied to analyze candies purchased from the market. The method is expected to be specific, sensitive, and reliable for analyzing bovine DNA in candy products. Amplification was also performed on soft candy reference from bovine gelatin. A sensitivity test was performed by measuring amplification at six dilution series (10000, 5000, 1000, 500, 50, and 10 pg) on bovine gelatin candies. The results show that the real-time PCR with primer mitochondrial cytochrome-B gene specifically able to identify the presence of bovine DNA in fresh tissue and gelatin sources at optimum annealing temperature 55,2°C. The limit of detection of porcine DNA was 500 pg. The standard curve of the serial dilution of the bovine gelatin DNA isolate produces a correlation coefficient R-value of 0.992 and an efficiency value (E) of 93.1%. Four products from the market were examined by using the primer showed three bovine DNA was detected. Real-time PCR using cytochrome-B DNA bovine primer (forward: ACTAGCCCTAGCCTTCTCTATC; reverse TGTCAGTAGGTCTGCTACTAGG) can be used for the Analysis of halal soft candy.

show abstract

Section: Resultsmentioning

confidence: 99%

The Employment of Real-Time Polymerase Chain Reaction for the Identification of Bovine Gelatin in Gummy Candy

et al. 2022

View full text Add to dashboard Cite

show abstract

“…( 2020 ) used DNA barcode technology combined with NGS to accurately identify the problem of various types of meat adulteration and even showed good detection performance in samples mixed with multiple types of meat and reprocessed samples. A real‐time loop‐mediated isothermal amplification method for detecting pig genes in meat products has been established by Cai et al., which is the first attempt to use real‐time LAMP to detect pig‐derived components in commercial products (Cai et al., 2020 ). Furthermore, Tian et al.…”

Section: Discussionmentioning

confidence: 99%

“…This indicates that raccoon adulteration can be quantitatively identified. LAMP to detect pig-derived components in commercial products (Cai et al, 2020). Furthermore, Tian et al (2019) conducted an odor fingerprint investigation on lamb meat adulterated with pork using an electronic nose system consisting of 10 selective MOS gas sensors using PEN 2 (Airsense, Germany).…”

Section: Detection Of Commercially Available Samplesmentioning

confidence: 99%

Research on quantitative detection technology of raccoon‐derived ingredient adulteration in sausage products

Wang,

Chen,

Xie

et al. 2024

Food Science & Nutrition

View full text Add to dashboard Cite

This project presents a quantitative detection method to identify raccoon‐derived ingredient adulteration in sausage products. The specific copy gene of the raccoon was selected as the target gene. According to the specificity of its primer and probe, the quantitative detection method of raccoon microdrops by droplet digital PCR was established. In addition, the accuracy of the proposed method was verified by artificially mixed samples, and the applicability of this method was tested based on the commercially available products. The experimental results indicate that the raccoon mass (M) and raccoon‐extracted DNA concentration have a good linear relationship when the sample content is 5–100 mg, and there is also a significant linear relationship between DNA content and DNA copy number (C) with R2 = .9982. Therefore, using DNA concentration as the median signal, the conversion equation between raw raccoon mass (M) and DNA copy number (C) could be obtained as follows: M = (C + 177.403)/16.954. The detection of artificially mixed samples and commercial samples shows that the method is accurate and suitable for quantitative adulteration detection of various sausage products in the market.

show abstract

“…Several promising isothermal amplification methods have emerged, while some of them need relatively high temperatures and/or a phase for complex primers design. For example, loop-mediated isothermal amplification (LAMP) requires 6–8 primers targeting different regions of the amplified fragment and working at 65 °C ( Cai, Kong, & Xu, 2020 ) and cross-priming amplification (CPA) relies on 5 primers to detect the target sequence at 63 °C ( Feng, Li, Wang, & Pan, 2018 ). In contrast, the RPA method works successfully over a wide temperature ranging from 37 ∼ 42 °C with a specific primer pair ( Yogesh Kumar, 2021 ).…”

Section: Introductionmentioning

confidence: 99%

Rapid detection of duck ingredient in adulterated foods by isothermal recombinase polymerase amplification assays

Zhou

Wang²,

Xiang³

et al. 2023

Food Chemistry: Molecular Sciences

View full text Add to dashboard Cite

Detection of porcine-derived ingredients from adulterated meat based on real-time loop-mediated isothermal amplification

Cited by 18 publications

References 35 publications

The Employment of Real-Time Polymerase Chain Reaction for the Identification of Bovine Gelatin in Gummy Candy

The Employment of Real-Time Polymerase Chain Reaction for the Identification of Bovine Gelatin in Gummy Candy

Research on quantitative detection technology of raccoon‐derived ingredient adulteration in sausage products

Rapid detection of duck ingredient in adulterated foods by isothermal recombinase polymerase amplification assays

Contact Info

Product

Resources

About