Detection of Human and Fish Viruses in Marine Gastropods

Abstract

Marine gastropods represent a major food source for higher trophic levels and an important source of animal protein for humans. Like bivalve molluscs, gastropods can accumulate several types of contaminants; however, the bioaccumulation of microorganisms, particularly viruses, has been poorly investigated in these animals. This study focused on gastropods (Tritia mutabilis, Bolinus brandaris and Rapana venosa) collected during the fishing season from 2017 to 2021 in the north-western Adriatic Sea, and on clams (Ruditapes philippinarum) harvested in the same geographical area, in order to evaluate the presence of human and fish viruses in their tissues. A virological investigation was carried out on the digestive gland using molecular methods. The presence of hepatitis A virus was detected in one sample, whereas noroviruses were not present in the investigated specimens. Regarding fish viruses, it was possible to detect the presence of nervous necrosis virus (NNV) in 26.5% of the analyzed gastropods; however, the histological examination did not show any pathological changes in the nervous tissue in both NNV-positive and -negative batches. As a whole, the investigated gastropods showed the ability to bioaccumulate viruses; however, lower contamination by human viruses compared to bivalve molluscs was pointed out, posing a minor concern to human health.

Exploring magnetic capture to improve the detection of human norovirus in strawberries

“…Then, 5 μL of cDNA were used as templates for PCR. PCR was carried out with 0.1 μM each dNTP, 0.2 μM each primer (JV12:ATACCACTATGATGCAGATTA; JV13:TCATCATCACCATAGAAAGAG (Errani et al., 2022)), 1 U of Taq polymerase in a final volume of 20 μL using a T100 thermal cycler (Bio‐Rad, Hercules, CA, USA) with 35 cycles of 30 s denaturation at 94°C, 30 s annealing at 60°C, and 30 s extension at 72°C. Cycling was launched after an initial denaturation at 94°C for 5 min and ended with a final extension at 72°C for 8 min.…”

“…Then, 5 µL of cDNA were used as templates for PCR. PCR was carried out with 0.1 µM each dNTP, 0.2 µM each primer (JV12:ATACCACTATGATGCAGATTA; JV13:TCATCATCACCATAGAAAGAG (Errani et al, 2022)), 1 U of Taq polymerase in a final volume of 20 µL using a T100 thermal cycler (Bio-Rad, Hercules, CA, USA) with 35 cycles of 30 s denaturation at 94 The steps of RNA isolation using a kit were completed according to its specification. In addition, we also explored whether these two RNA isolation methods could distinguish dead or live viruses.…”

Application of the Human Viral Surrogate Pepper Mild Mottle Virus for Wastewater Fecal Pollution Management

“…Enteric viruses are extremely contagious in ambient waters and can stick to particles in the water column or accumulate in sediment [57]. They might subsequently be consumed by aquatic organisms, such as bivalve shellfish harvested for human consumption [58]. Additionally, wastewater is regularly used for irrigation in areas with a shortage of freshwater; as a result, enteric viruses may directly contaminate fruit and salad vegetables, and result in foodborne outbreaks [54].…”

Redspotted Grouper Nervous Necrosis Virus and the Reassortant RGNNV/SJNNV In Vitro Susceptibility against a Commercial Peroxy-Acid Biocide under Different Conditions of Use

“…However, the emergence of the RGNNV/SJNNV reassortant strain derived from the reassortment between RGNNV and SJNNV genotypes also caused high mortality outbreaks in gilthead sea bream ( Sparus aurata ) larvae [ 4 , 10 ]. Moreover, NNV has also been detected in numerous wild marine fish species and invertebrates in the Mediterranean Sea [ 11 , 12 , 13 ]. Notably, NNV-contaminated bivalve mollusks can release infectious viral particles into waters and the surrounding environment, representing a viral source [ 14 ].…”