Detection of hepatitis C viral sequences in blood donations by "nested" polymerase chain reaction and prediction of infectivity

Garson, Jeremy A.; Tedder, Richard S.; Briggs, Moya; Tuke, Philip W.; Glazebrook, J. A.; Trute, A.; Parker, Dawn D.; Barbara, J. A. J.; Contreras, Marcela; Aloysius, S.

doi:10.1016/0140-6736(90)91446-h

Cited by 536 publications

(172 citation statements)

References 14 publications

Supporting

Mentioning

166

Contrasting

Unclassified

Order By: Relevance

“…All the patients were HCV-RNA-positive, as determined by the reverse-transcriptase polymerase chain reaction method. 25 The clinicopathologic data for these patients are also shown in Table 1. Five normal liver tissue samples also were obtained from patients with liver metastases of colon cancer (4 men and 1 woman; mean age, 60.2 Ϯ 4.2 years; range, 56 to 67 years) during surgery ( Table 1, patients 21 through 25).…”

Section: Methodsmentioning

confidence: 99%

Cyclins and cyclin-dependent kinases: Comparative study of hepatocellular carcinoma versus cirrhosis

et al. 2003

View full text Add to dashboard Cite

Increasing evidence has indicated that perturbation of cyclins is one of the major factors leading to cancer. The aim of this study was not only to investigate various cell cycle-related kinase activities in hepatocellular carcinoma (HCC), but also to analyze the difference of cell cycle-related kinase activity levels between hepatitis C virus (HCV)-induced HCC and HCVinduced cirrhosis. The protein levels of cyclins D1, E, A, and H, and of cyclin dependent kinase 1 (Cdk1), Cdk2, Cdk4, Cdk6, and Cdk7 in HCC and in surrounding nontumorous cirrhosis were determined by Western blot. The enzymatic activities of cyclins D1, E, A, Cdk1, Cdk4, Cdk6, Cdk7, and Wee1 were measured using in vitro kinase assays. Protein levels and kinase activities of cyclin D1, Cdk4, cyclin E, cyclin A, and Wee1 were significantly elevated in HCC compared with surrounding cirrhotic tissues. The enhanced cyclin D1-related kinase activity in HCC was accompanied by the up-regulation of Cdk4 activity, but not Cdk6 activity. The kinase activities of Cdk6, Cdk7, and Cdk1 did not differ between HCC and surrounding cirrhotic tissues. In addition, the protein levels and kinase activities of cyclin D1, Cdk4, and cyclin E were higher in poorly differentiated HCC and advanced HCC. In conclusion, the increases of cyclin D1, Cdk4, cyclin E, cyclin A, and Wee1 play an important role in the development of HCC from cirrhosis. Cyclin D1, Cdk4, and cyclin E activation may be closely related to the histopathologic grade and progression of HCC. R ecent studies, including our research, have revealed that the deranged expression of cell cyclerelated proteins is one of the major factors contributing to hepatocellular carcinoma (HCC) development. 1-6 Here we investigated biochemical differences of various cell cycle-related kinase activities and protein levels in cirrhosis and HCC.Specific cyclin/cyclin-dependent kinase (Cdk) complexes are activated at different intervals during the cell cycle. 7-15 Cyclin D1/Cdk4 and cyclin D1/Cdk6 are activated in mid-G1 (Fig. 1, phase 1), whereas cyclin E/Cdk2 complexes are required for the G1/S transition (Fig. 1, phase 2), cyclin A/Cdk2 for the progression of DNA synthesis (Fig. 1, phase 3), and cyclin A-B/Cdk1 for the G2/M transition (Fig. 1, phase 4) of mitosis. The activation of cyclin D1/Cdk4 and cyclin D1/Cdk6 complexes at mid-G1 is responsible for the phosphorylation of retinoblastoma protein (pRb), and 2 Rb related proteins, p107, and p130. Members of the pRb family form complexes with transcription factors of the E2F family. 16 This interaction with pRb family members blocks the transcriptional activity of E2Fs; the complexes formed also function as active transcriptional repressor complexes at the promoters of some cell cycle genes. Phosphorylation of the pRb family inhibits the interaction with E2F family transcription factor and permits the expression of genes necessary for S-phase entry (cyclin A, proliferating cell nuclear antigen, and so on). 17 The expression of cyclins E and A at mid-to late-G1 permits the form...

show abstract

Section: Methodsmentioning

confidence: 99%

Cyclins and cyclin-dependent kinases: Comparative study of hepatocellular carcinoma versus cirrhosis

et al. 2003

View full text Add to dashboard Cite

show abstract

“…Primers NCR2 (5' ATACTCGAGGTGC ACGGTCTACGAGACCT 3'), PTC1 (5' CG TTAGTATGAGTGTCGTGC 3'), PTC3 (5' AGTGTCGTGCAGCCTCCAGG 3') and NCR4 (5' CACTCTCGAGCACCCTATCA GGCAGT 3') were used (9,10). As shown in Figure 1, these primers cover the following nucleotide positions in the 5' untranslated region (5'UTR): PTC1 (81-98), PTC3 (99-108), NCR4 (288-313), and NCR2 (323-341) according to the HCV sequence described by Choo et al (11), locus HPCPLYPRE, GenBank accession No.…”

Section: Primersmentioning

confidence: 99%

Geographic distribution of hepatitis C virus genotypes in Brazil

Campiotto

Pinho

Carrilho

et al. 2005

Braz J Med Biol Res

174

102

View full text Add to dashboard Cite

Brazil is a country of continental dimension with a population of different ethnic backgrounds. Thus, a wide variation in the frequencies of hepatitis C virus (HCV) genotypes is expected to occur. To address this point, 1,688 sequential samples from chronic HCV patients were analyzed. HCV-RNA was amplified by the RT-PCR from blood samples collected from 1995 to 2000 at different laboratories located in different cities from all Brazilian States. Samples were collected in tubes containing a gel separator, centrifuged in the site of collection and sent by express mail in a refrigerated container to Laboratório Bioquímico Jardim Paulista, São Paulo, SP, Brazil. HCV-RNA was extracted from serum and submitted to RT and nested PCR using standard procedures. Nested PCR products were submitted to cycle sequencing reactions without prior purification. Sequences were analyzed for genotype determination and the following frequencies were found: 64.9% (1,095) for genotype 1, 4.6% (78) for genotype 2, 30.2% (510) for genotype 3, 0.2% (3) for genotype 4, and 0.1% (2) for genotype 5. The frequencies of HCV genotypes were statistically different among Brazilian regions (P = 0.00017). In all regions, genotype 1 was the most frequent (51.7 to 74.1%), reaching the highest value in the North; genotype 2 was more prevalent in the Center-West region (11.4%), especially in Mato Grosso State (25.8%), while genotype 3 was more common in the South (43.2%). Genotypes 4 and 5 were rarely found and only in the Southeast, in São Paulo State. The present data indicate the need for careful epidemiological surveys throughout Brazil since knowing the frequency and distribution of the genotypes would provide key information for understanding the spread of HCV.

show abstract

“…The second amplification was performed using 3 µL of the first amplification product and a mixture of the same composition as described above, but using the inner primers, 0.2 mM dNTP mix and 1.5 mM MgCl 2 . The second PCR amplification product was separated by electrophoresis on 1.5% agarose gel stained with ethidium bromide and visualized under ultraviolet light 9 .…”

Section: Detection Of Hcv-rnamentioning

confidence: 99%

Serological, epidemiological and molecular aspects of hepatitis C virus infection in a population from Londrina, PR, Brazil, 2001-2002

Vogler

Nishiya

Morimoto

et al. 2004

Rev. Inst. Med. trop. S. Paulo

View full text Add to dashboard Cite

SUMMARYSerological, epidemiological and molecular aspects of hepatitis C virus (HCV) infection were evaluated in 183 subjects from Londrina, Paraná, Brazil, and adjacent areas. Serum samples which tested anti-HCV positive by microparticle enzyme immunoassay (MEIA) obtained from eight patients with chronic hepatitis C, 48 blood donors, and 127 patients infected with the human immunodeficiency virus (HIV) were submitted to another enzyme immunoassay (ELISA) and to the polymerase chain reaction (PCR). About 78.7% of samples were also reactive by ELISA, with the greater proportion (70.8%) of discordant results verified among blood donors. A similar finding was observed for HCV-RNA detection by PCR, with 111/165 (67.3%) positive samples, with higher rates among HIV-positive subjects and patients with chronic hepatitis than among blood donors. Sixty-one PCRpositive samples were submitted to HCV genotyping, with 77.1, 21.3 and 1.6% of the samples identified as types 1, 3 and 2, respectively. Finally, analysis of some risk factors associated with HCV infection showed that intravenous drug use was the most common risk factor among HIV/HCV co-infected patients, while blood transfusion was the most important risk factor in the group without HIV infection. The present study contributed to the knowledge regarding risk factors associated with HCV infection and the distribution of HCV genotypes in the population evaluated. KEYWORDS:Hepatitis C virus; Anti-HCV; Genotypes; Epidemiology. INTRODUCTIONAbout 170 million people all over the world are infected with hepatitis C virus (HCV), although many ignore such fact 30 . In most cases, the infection develops as an asymptomatic clinical picture but with severe consequences, since about 80% of the infected subjects develop chronic hepatitis, cirrhosis or hepatocellular carcinoma 16,28 .Co-infection of HCV-infected subjects with the human immunodeficiency virus (HIV) has important implications for the prognosis and management of both diseases. These subjects show elevated alanine aminotransferase levels and are at a higher risk of developing fibrosis, cirrhosis, liver failure or hepatocellular carcinoma than subjects infected only with HCV 6 ; in addition, they show a higher risk of developing hepatic toxicity related to the use of highly active antiretroviral therapy than patients infected only with HIV 5,26 .The use of the polymerase chain reaction (PCR) for the detection of HCV-RNA allows the identification of the presence of active HCV infection. However, RNA levels may show fluctuations with nondetectable periods even in patients not submitted to interferon therapy 7 .Patient counseling regarding the risk-benefit of treatment also requires analysis of a liver biopsy and the determination of the HCV genotype. Differences in the response to treatment depending on the HCV genotype have been observed, with type 1 being more resistant than types 2 and 3 19 . Genotyping based on the amplification of the 5' untranslated region (5'-UTR) has the advantage that it can be performed on PCR ...

show abstract

Detection of hepatitis C viral sequences in blood donations by "nested" polymerase chain reaction and prediction of infectivity

Cited by 536 publications

References 14 publications

Cyclins and cyclin-dependent kinases: Comparative study of hepatocellular carcinoma versus cirrhosis

Cyclins and cyclin-dependent kinases: Comparative study of hepatocellular carcinoma versus cirrhosis

Geographic distribution of hepatitis C virus genotypes in Brazil

Serological, epidemiological and molecular aspects of hepatitis C virus infection in a population from Londrina, PR, Brazil, 2001-2002

Contact Info

Product

Resources

About