Detection of gene expression of vascular endothelial growth factor and flk-1 in the renal glomeruli of the normal rat kidney using the laser microdissection system

Abstract

The recent development of the laser microdissection (LMD) technique enables one to target particular tissues or cells for gene or protein analyses. The purpose of this study was to detect local mRNA expression of vascular endothelial growth factor (VEGF) and its receptor, flk-1, in the glomeruli of normal rat kidneys using the LMD system. Frozen sections of the kidney of 8-week-old male Wistar rats were made. The glomeruli were dissected from the frozen sections with the LMD system, and total RNA was extracted from 200 glomeruli in each kidney. Reverse-transcription polymerase chain reaction (RT-PCR) revealed the local mRNA expression of three isoforms of VEGF, flk-1 and GAPDH in the glomeruli. Moreover, the real-time PCR was performed to evaluate the experimental condition for quantification of VEGF and flk-1 mRNA expression using this system, and the results showed that at least 10 glomeruli might be needed for quantifying local VEGF mRNA expression. However, cDNA from 200 glomeruli was not enough for quantitative evaluation of flk-1 mRNA with this system. These results demonstrate the reproducibility of the analysis of mRNA expression in the renal glomeruli using the LMD system and also suggest that the application of the LMD technique will provide information to further our understanding of the mechanisms involved in kidney diseases.

Pharmacological inhibition of the lipid phosphatase PTEN ameliorates heart damage and adipose tissue inflammation in stressed rats with metabolic syndrome

“…Total RNA was prepared from LV or epididymal AT as described (Matsuura, Asano, et al, 2015 ) and was subjected to reverse transcription (RT) with a PrimeScript RT Reagent Kit (Takara). The resultant cDNA was amplified by real‐time polymerase chain reaction (PCR) analysis as performed with SYBR Mix Ex Taq II (Takara), a Thermal Cycler Dice Real Time System II (Takara), and specific primers for atrial natriuretic peptide (ANP; Nagata et al, 2002 ) brain natriuretic peptide (BNP; Nagata et al, 2002 ) monocyte chemoattractant protein‐1 (MCP‐1; Nagata et al, 2006 ) osteopontin (Nagata et al, 2006 ), tumor necrosis factor‐α (TNF‐α; Murase, Hattori, Ohtake, Abe, et al, 2012 ) collagen type I or type III (Sakata et al, 2004 ), vascular endothelial growth factor A (VEGF‐A; Inoue et al, 2003 ) hypoxia‐inducible factor‐1α (HIF‐1α; Miyachi et al, 1979 ) endothelial nitric oxide synthase (eNOS; Hudlicka et al, 1992 ) cyclooxygenase‐2 (COX‐2; Murase, Hattori, Ohtake, Nakashima, et al, 2012 ) or IL‐10 (Xing et al, 2012 ). The abundance of mRNAs for target genes was normalized by the amount of glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) mRNA (forward and reverse primers of 5′‐GGGGTGATGCTGGTGCTGAG‐3′ and 5′‐GGTGCAGGATGCATTGCTGAC‐3′, respectively; GenBank accession no.…”

Microdissection—An Essential Prerequisite for Spatial Cancer Omics

“…Both systems use a UV diode laser, in case of LMD coupled in an upright microscope. [ 18 ] Here the cut probe is not catapulted into the lid of a tube, but instead, overcoming adhesive forces, falling into a vessel underneath the slide. This process is also contamination free.…”

Surgical ablation of whitened interscapular brown fat ameliorates cardiac pathology in salt‐loaded metabolic syndrome rats

“…17 Portions of RNA (2 μg) were subjected to reverse transcription (RT) with the use of a PrimeScript RT Reagent Kit (Takara, Shiga, Japan), and the resulting cDNA was subjected to quantitative polymerase chain reaction (PCR) analysis using SYBR R Mix Ex Taq II (Takara); a Thermal Cycler Dice Real-Time System II (Takara); and specific primers for the following cDNAs: atrial natriuretic peptide (ANP), 11 brain natriuretic peptide (BNP), 11 collagen types I or III, 18 connective tissue growth factor (CTGF), 19 transforming growth factor-β1 (TGF-β1), 11 monocyte chemoattractant protein-1 (MCP-1), 19 cyclooxygenase-2 (COX-2), 20 osteopontin, 19 tumor necrosis factor-α (TNF-α), 7 adipose triglyceride lipase (ATGL, NM_00110859.2), hormonesensitive lipase (HSL, NM_012859.1), UCP1, 8 cell death-inducing DNA fragmentation factor α-like effector A (CIDE-A, NM_001170467.1), peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α, NM_031347.1), or vascular endothelial growth factor-A (VEGF-A). 21 Reagents for the detection of human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA (Applied Biosystems, Foster City, CA) were used to quantify rat GAPDH mRNA as an internal standard.…”