Detection of cranberry fruit rot fungi using DNA array hybridization

Robideau, G.P.; Caruso, Frank L.; Oudemans, Peter V.; McManus, Patricia S.; Renaud, Mario; Auclair, M. E.; Bilodeau, Guillaume J.; D, Yee; Désaulniers, N. L.; DeVerna, J. W.; Lévesque, C. André

doi:10.1080/07060661.2008.10540538

Cited by 15 publications

(17 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Tambong et al . (2006) and Robideau et al . (2008) developed their oligonucleotide arrays using ITS data sets.…”

Section: Discussionmentioning

confidence: 96%

“…The presence of indels or introns in this region may or may not be favourable for full-length barcode identification, but such sites provide obvious polymorphism locations for designing oligonucleotides that are less likely to crossreact with unintended targets. Tambong et al (2006) and Robideau et al (2008) developed their oligonucleotide arrays using ITS data sets. Probes designed from polymorphisms in indels sites ensured high specificity of both arrays.…”

Section: Discussionmentioning

confidence: 99%

“…The short oligonucleotide ST1 (5′‐CACGGCGATTTCGCAGTTTA‐3′) was used as hybridization control (Tambong et al . 2006; Robideau et al . 2008).…”

Section: Methodsmentioning

confidence: 99%

“…Positive PCR controls included forward and reverse primers, namely PenF1 (5′-GACAAGAAAGGTGATTTTTATCTTC-3′) and AspR1 (5′-GGTAATGATAATAATAATAATACAGCTG-3′), respectively, were used to amplify the COX1 barcode regions of Penicillium subgenus Penicillium. The short oligonucleotide ST1 (5′-CACGGCGATTTCGCAGTTTA-3′) was used as hybridization control (Tambong et al 2006;Robideau et al 2008). Amine-modified oligonucleotides were diluted from 200 μm stock to 40 μm with 0.5 m sodium hydrogen carbonate buffer (4.2 g NaHCO 3 , 99 mL HPLC water, 1 mL of 0.004% bromophenol blue, pH 8.4) in a sterile 384-well microplate (Whatman Inc.) and were in a specific pattern to group oligonucleotides designed for the same species/clade.…”

Section: Spotting Of Dna Array At Near-microarray Densitymentioning

confidence: 99%

See 3 more Smart Citations

A high density COX1 barcode oligonucleotide array for identification and detection of species of Penicillium subgenus Penicillium

Chen

Seifert

Lévesque

2009

Molecular Ecology Resources

View full text Add to dashboard Cite

We developed a COX1 barcode oligonucleotide array based on 358 sequences, including 58 known and two new species of Penicillium subgenus Penicillium, and 12 allied species. The array was robotically spotted at near microarray density on membranes. Species and clade-specific oligonucleotides were selected using the computer programs SigOli and Array Designer. Robotic spotting allowed 768 spots with duplicate sets of perfect match and the corresponding mismatch and positive control oligonucleotides, to be printed on 2 × 6 cm 2 nylon membranes. The array was validated with hybridizations between the array and digoxigenin (DIG)-labelled COX1 polymerase chain reaction amplicons from 70 pure DNA samples, and directly from environmental samples (cheese and plants) without culturing. DNA hybridization conditions were optimized, but undesired cross-reactions were detected frequently, reflecting the relatively high sequence similarity of the COX1 gene among Penicillium species. Approximately 60% of the perfect match oligonucleotides were rejected because of low specificity and 76 delivered useful group-specific or species-specific reactions and could be used for detecting certain species of Penicillium in environmental samples. In practice, the presence of weak signals on arrays exposed to amplicons from environmental samples, which could have represented weak detections or weak cross reactions, made interpretation difficult for over half of the oligonucleotides. DNA regions with very few single nucleotide polymorphisms or lacking insertions/deletions among closely related species are not ideal for oligonucleotidebased diagnostics, and supplementing the COX1-based array with oligonucleotides derived from additional genes would result in a more robust hierarchical identification system.

show abstract

“…Tambong et al . (2006) and Robideau et al . (2008) developed their oligonucleotide arrays using ITS data sets.…”

Section: Discussionmentioning

confidence: 96%

Section: Discussionmentioning

confidence: 99%

“…The short oligonucleotide ST1 (5′‐CACGGCGATTTCGCAGTTTA‐3′) was used as hybridization control (Tambong et al . 2006; Robideau et al . 2008).…”

Section: Methodsmentioning

confidence: 99%

Section: Spotting Of Dna Array At Near-microarray Densitymentioning

confidence: 99%

See 2 more Smart Citations

A high density COX1 barcode oligonucleotide array for identification and detection of species of Penicillium subgenus Penicillium

Chen

Seifert

Lévesque

2009

Molecular Ecology Resources

View full text Add to dashboard Cite

show abstract

“…In a DNA-array study with large sample size, Robideau et al (2008) examined 2000 fruit samples for evidence of fungal pathogens. They showed that as the sample size increased, the number of false negatives in the molecular assay increased up to 20% as compared with direct detection via plating, because calyx colonists grow readily on plates, but have low biomasses in fruit samples.…”

Section: Data Needsmentioning

confidence: 99%

Assessing Macroinvertebrate Biodiversity in Freshwater Ecosystems: Advances and Challenges in DNA-based Approaches

Pfrender

Hawkins

Bagley³

et al. 2010

The Quarterly Review of Biology

View full text Add to dashboard Cite

Assessing the biodiversity of macroinvertebrate fauna in freshwater ecosystems is an essential component of both basic ecological inquiry and applied ecological assessments. Aspects of taxonomic diversity and composition in freshwater communities are widely used to quantify water quality and measure the efficacy of remediation and restoration efforts. The accuracy and precision of biodiversity assessments based on standard morphological identifications are often limited by taxonomic resolution and sample size. Morphologically based identifications are laborious and costly, significantly constraining the sample sizes that can be processed. We suggest that the development of an assay platform based on DNA signatures will increase the precision and ease of quantifying biodiversity in freshwater ecosystems. Advances in this area will be particularly relevant for benthic and planktonic invertebrates, which are often monitored by regulatory agencies. Adopting a genetic assessment platform will alleviate some of the current limitations to biodiversity assessment strategies. We discuss the benefits and challenges associated with DNA-based assessments and the methods that are currently available. As recent advances in microarray and next-generation sequencing technologies will facilitate a transition to DNA-based assessment approaches, future research efforts should focus on methods for data collection, assay platform development, establishing linkages between DNA signatures and well-resolved taxonomies, and bioinformatics. RightsWorks produced by employees of the U.S. Government as part of their official duties are not copyrighted within the U.S. The content of this document is not copyrighted. Authors

show abstract

Isolation Techniques Used for Molecular Characterization of Beneficial Microorganisms

Dabban,

Ahmad,

Enejiyon

et al. 2024

Handbook of Agricultural Biotechnology

View full text Add to dashboard Cite

Detection of cranberry fruit rot fungi using DNA array hybridization

Cited by 15 publications

References 46 publications

A high density COX1 barcode oligonucleotide array for identification and detection of species of Penicillium subgenus Penicillium

A high density COX1 barcode oligonucleotide array for identification and detection of species of Penicillium subgenus Penicillium

Assessing Macroinvertebrate Biodiversity in Freshwater Ecosystems: Advances and Challenges in DNA-based Approaches

Isolation Techniques Used for Molecular Characterization of Beneficial Microorganisms

Contact Info

Product

Resources

About