Detection of clonal CD34+19+ progenitors in bone marrow of BCL2-IgH- positive follicular lymphoma patients

Abstract

The frequent occurrence of BCL2-IgH rearrangements in follicular lymphoma (FL) makes detection of low numbers of tumor cells possible by polymerase chain reaction (PCR). The presence of BCL2-IgH in the bone marrow (BM) and peripheral blood of many FL patients at the time of autografting has led to the suggestion that selection of the CD34- enriched fraction may lead to reinfusion of lower numbers of tumor cells. To address this issue, we PCR-amplified BCL2-IgH from fluorescence-activated cell sorting (FACS)-purified BM CD34+ and CD34- fractions in seven FL patients showing a PCR-detectable translocation in the major breakpoint region of BCL2, five of which showed morphological BM involvement. The total CD34+ fraction showed diminished but residual positivity in the first two cases tested. Therefore, BM cells from the remaining five patients were sorted for the CD34+19- immature population, the CD34+19+ B-cell precursors, and the CD34–19+ mature B-cell fraction. The CD34+19- subpopulation was negative in four of five, despite evident BM infiltration in three cases. In contrast, the CD34+19+ fraction was positive in all three cases tested. These cells represented 0% to 50% (mean, 18%) of the total CD34+ population, suggesting that, if reinfusion of BCL2-IgH- positive cells plays a role in postautograft relapse in FL, therapeutic CD34 selection procedures should include additional purging of the CD34+19+ B-cell precursors or, at least, assessment of the proportion of CD19+ cells in the CD34+ fraction and its correlation with clinical outcome postreinfusion.

Genetic analysis of splenic lymphoma with villous lymphocytes: a Groupe Français d'Hématologie Cellulaire (GFHC) study

“…1 μg was amplified using a chromosome 11q13 BCL oligonucleotide specific for the MTC breakpoint cluster ( Rimokh et al , 1994a ), (5′‐GGGCTTCTCTCACCTACTAATATCG‐3′) and a chromosome 14 consensus IgH JH oligonucleotide (5′‐ACCTGAGGAGACGGTGACCAGGGT‐3′) for 35 cycles. PCR conditions were essentially as previously described ( Macintyre et al , 1995 ). Hybridization was performed at 62°C for 1 min.…”

FISH detection of chromosome 14q32/IgH translocations: evaluation in follicular lymphoma

“…ImmunoFISH analysis of the CD34-positive fraction from one case demonstrated that the split signals were not present preferentially in contaminating CD34-negative cells. We have previously identified BCL2-IgH rearrangments by PCR in the CD34-positive fraction, but with an estimated incidence of approximately 10 ¹3 (Macintyre et al, 1996). This level of detection is well below that obtained by the FISH strategies used here, even for cytogenetic preparations by IgH-BCL2 co-localization.…”

“…FISH analysis combined with either morphological assessment or immunological staining (such as FICTION) (Weber-Matthiesen et al, 1992) also enables determination of the cell of origin of the cytogenetic abnormality. We have previously identified IgH-BCL2 rearrangement by PCR in CD34-positive bone marrow cells from FL patients, particularly in the CD34 þ CD19 þ , pre-B-cell fraction (Macintyre et al, 1996). In an attempt to determine whether this was due to contamination of the CD34 þ CD19 þ fraction by mature FL cells or to the presence of the t(14;18) in CD34-positive cells, we used the IgH and IgH-BCL2 probes to analyse cytospins of CD34 flow sorted cells from patients with FL.…”

“…PCR detection of IgH-BCL2. PCR detection of IgH-BCL2 (Major Breakpoint Region -MBR and Minor Cluster Region -MCR) rearrangements was undertaken from DNA as previously described (Macintyre et al, 1996).…”

Combined isolation of CD34+ progenitor cells and reduction of B cells from peripheral blood by use of immunomagnetic methods

“…And finally, there is a controversial possibility of some malignant cells expressing the CD34 antigen. In this sense, Macintyre et al 35 showed positivity for bcl2-IgH in the FACS-sorted marrow CD34+ cell population from five patients with follicular lymphoma and in the CD34+ and CD19+ subpopulation in 3 of 3 patients tested whereas the CD34+ and CD19-subset was PCR negative in 4 of 5 cases. In contrast, Voso et al 27 found that the immunomagnetic and FACSsorted marrow CD34+ cells, including the CD34+ and CD19+ subpopulation, were negative for bcl2-IgH in 13 of 14 patients with follicular lymphoma.…”