Detection of circulating cells expressing chromogranin A gene transcripts in patients with lung neuroendocrine carcinoma

Bégueret, Hugues; Vergier, Béatrice; Bégueret, Joël; Vernejoux, J.-M.; Jougon, Jacques; Trouette, R.; Taytard, A; Velly, Jean-François; Merlio, Jean-Philippe; Mascarel, A. De

doi:10.1016/s0959-8049(02)00453-7

Cited by 5 publications

(8 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Although CHGA transcript has been tested as a specific marker in SCLC (8), in this study, we detected CHGA transcripts in four of five nonneuroendocrine NSCLC cell lines. CHGB, VGF, PCSK1, and PCSK2 were also expressed in several NSCLC.…”

Section: Resultsmentioning

confidence: 75%

“…Whereas CHGA, CHGB and PCSK1 (5,8,27,28) are established markers for SCLC, to the best of our knowledge, VGF and SCG3 have not been previously characterized in lung cancer. We initially screened a panel of SCLC, carcinoid (NCI-H727), nonneuroendocrine NSCLC and control cell lines by conventional RT-PCR to correlate transcription with REST status for these genes (Fig.…”

Section: Resultsmentioning

confidence: 91%

“…Although neuromedin B receptor-positive patients showed a trend toward worse survival, by log-rank test, this was not significant in their cohort of 44 SCLC patients or among the 21 patients with LD (11). Furthermore, although CHGA transcript was reported to be associated with an increased lethal risk, patients positive for CHGA exhibited a better mean survival than CHGA mRNA-negative patients (8). Although the extent of disease at diagnosis is important in determining survival, this is only used to group SCLC patients as LD or ED and there is potential additional benefit in using a biomarker like SCG3 to stratify the LD patients into better or worse survival groups.…”

Section: Discussionmentioning

confidence: 99%

“…Sequences used to design primers were CGHA (NM_001275; ref. 8), CHGB (NM_001819.1), PCSK1 (NM_000439.3), SCG3 (NM_013243), VGF (NM_003378), PCSK2 (NM_002594.2), and SCG2 (NM_003469). cDNA (100 AL) was first synthesized from 1 Ag total RNA by reverse transcription (Promega).…”

Section: Methodsmentioning

confidence: 99%

“…SCG3 RT-PCR products were electrophoresed, transferred to Hybond-XL (GE Healthcare), and probed with g-32 P end-labeled oligonucleotide (ACTACTTAATCTCGGCCTTATCA-CAGAAAGCCAAGCA) spanning exon 5/6 of SCG3 (NM_013243). Samples were processed in the same way for CHGA using the previously described primers and probe (8) and for SCG2 or PCSK2 with oligonucleotide probes (CAAAAAGAGGAAATCTTTCAAACATGGCT-GAAG and CTGGCCTCCAACTATAATGCCGAAGCAAG, respectively). Membranes were hybridized with probes (24) for 16 h, then washed to a stringency of 2Â SSC/0.1% SDS at 65jC, and exposed to autoradiography film at -80jC for 1 h up to 72 h. All patient samples were tested in duplicate for SCG3; samples were classed as positive if the transcript was detected at least once on 72 h exposure.…”

Section: Translational Relevancementioning

confidence: 99%

See 4 more Smart Citations

SCG3 Transcript in Peripheral Blood Is a Prognostic Biomarker for REST-Deficient Small Cell Lung Cancer

Moss

Jacobson²,

Walker³

et al. 2008

Clinical Cancer Research

View full text Add to dashboard Cite

Purpose: Specific markers of circulating tumor cells may be informative in managing lung cancer.Because the RE-1silencing transcription factor (REST/NRSF) is a transcriptional repressor that is inactivated in neuroendocrine lung cancer, we identified REST-regulated transcripts (CHGA, CHGB, SCG3,VGF, and PCSK1) for evaluation as biomarkers in peripheral blood. Experimental Design: Transcripts were screened across lung cancer and normal cell lines. Candidates were assessed by reverse transcription-PCR and hybridization of RNA extracted from the peripheral blood of 111 lung cancer patients obtained at clinical presentation and from 27 cancer-free individuals. Results: Expression profiling revealed multiple chromogranin transcripts were readily induced on RESTdepletion, most notably SCG3 was induced >500-fold.The SCG3 transcript was also overexpressed by 12,000-fold in neuroendocrine compared with nonneuroendocrine lung cancer cells. In peripheral blood of lung cancer patients and cancer-free individuals, we found that SCG3 was more tumor-specific and more sensitive than other chromogranin transcripts as a biomarker of circulating tumor cells. Overall, 36% of small cell lung cancer (SCLC) and 16% of non-SCLC patients scored positively for normalized SCG3 transcript. This correlated with worse survival among SCLC patients with limited disease (n = 33; P = 0.022) but not extensive disease (n = 29; P = 0.459). Interestingly, the subcohort of 6 SCLC patients with resistance to platinum/ etoposide chemotherapy all scored positively for peripheral blood SCG3 transcript (P = 0.022). Conclusions: SCG3 mRNA, a component of the REST-dependent neurosecretory transcriptional profile, provides a sensitive prognostic biomarker for noninvasive monitoring of neuroendocrine lung cancer.

show abstract

Section: Resultsmentioning

confidence: 75%

Section: Resultsmentioning

confidence: 91%

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Translational Relevancementioning

confidence: 99%

See 3 more Smart Citations

SCG3 Transcript in Peripheral Blood Is a Prognostic Biomarker for REST-Deficient Small Cell Lung Cancer

Moss

Jacobson²,

Walker³

et al. 2008

Clinical Cancer Research

View full text Add to dashboard Cite

show abstract

Reciprocal CD4+ T-Cell Balance of Effector CD62Llow CD4+ and CD62LhighCD25+ CD4+ Regulatory T Cells in Small Cell Lung Cancer Reflects Disease Stage

Koyama

Kagamu

Miura

et al. 2008

Clinical Cancer Research

113

View full text Add to dashboard Cite

Purpose: Small cell lung cancer (SCLC) possesses high tendency to disseminate. However, SCLC patients with paraneoplastic syndrome mediated by immunity against onconeural antigens remain in limited-stage disease (LD) without distant metastases. Cumulative evidence regulates that a balance between immune and regulatory T (Treg) cells determines the magnitude of immune responses to not only self-antigens but also tumor-associated antigens. The purpose of this study was to elucidate the immunologic balance induced in SCLC patients. + T-cell balance may be a biomarker that distinguishes ED-SCLC from LD-SCLC and predicts recurrence. This study also suggests the importance of inducingTeff cells, particularlyTh17 cells, while eliminatingTreg cells to control systemic dissemination of SCLC.

show abstract

Prognostic Value of Synaptophysin and Chromogranin A Expression in Patients Receiving Palliative Chemotherapy for Advanced Non-Small-Cell Lung Cancer

Kowalski

Krzakowski²,

Jaśkiewicz³

et al. 2012

Respiration

View full text Add to dashboard Cite

Background: Chemotherapy is the principal treatment method for patients with advanced non-small-cell lung cancer (NSCLC). Treatment with platinum-based and novel chemotherapeutic regimens, compared to monotherapy, slightly increases the response rates to 20-40%. The predictive and prognostic values of molecular factors are highly variable; however, data on clinical-demographic factors are still burdened by significant limitations. Objectives: The aim of this study was to assess the prognostic value of synaptophysin and chromogranin A protein expression in patients receiving palliative chemotherapy for advanced NSCLC. Methods: The study population consisted of 23 women and 116 men. The median age was 57.3 years. Expression of synaptophysin and chromogranin was assessed using a two-step model of immunohistochemical staining. Level 0 represented lack of activity, while level 1 represented its expression. Results: Expression of synaptophysin and chromogranin A was observed in 12 (8.6%) and 5 (3.6%) patients, respectively. The risk of death was significantly lower in patients with expression of synaptophysin (p = 0.008) and chromogranin A (p = 0.014). The 12- and 24-month survival rate of patients with synaptophysin expression was 64% (95% CI 0.35-0.93), while for patients without expression it was 46% (95% CI 0.36-0.56) and 16% (95% CI 0.07-0.25), respectively. The 12- and 24-month survival rate of patients with chromogranin expression was 80% (95% CI 0.44-1.00), while for chromogranin A-negative patients it was 47% (95% CI 0.37-0.57) and 19% (95% CI 0.10-0.28), respectively. We did not observe associations between expression of synaptophysin and chromogranin A and the other typical prognostic factors. Conclusions: Expression of synaptophysin and chromogranin A was associated with a longer median overall survival and might have prognostic value. These results should be confirmed in a prospective study.

show abstract

Detection of circulating cells expressing chromogranin A gene transcripts in patients with lung neuroendocrine carcinoma

Cited by 5 publications

References 15 publications

SCG3 Transcript in Peripheral Blood Is a Prognostic Biomarker for REST-Deficient Small Cell Lung Cancer

SCG3 Transcript in Peripheral Blood Is a Prognostic Biomarker for REST-Deficient Small Cell Lung Cancer

Reciprocal CD4+ T-Cell Balance of Effector CD62Llow CD4+ and CD62LhighCD25+ CD4+ Regulatory T Cells in Small Cell Lung Cancer Reflects Disease Stage

Prognostic Value of Synaptophysin and Chromogranin A Expression in Patients Receiving Palliative Chemotherapy for Advanced Non-Small-Cell Lung Cancer

Contact Info

Product

Resources

About