Detection of Cervical Infections in Colposcopy Clinic Patients

Lanham, Stuart; Herbert, Amanda; Basarab, Adriana; Watt, P. J.

doi:10.1128/jcm.39.8.2946-2950.2001

Cited by 21 publications

(25 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Bacterial DNA was released from infected cells and chlamydiae by heating in the presence of ammonia, followed by the removal of alkali by evaporation for a fixed length of time (Lanham et al, 2001). Using the procedure as described produced PCR results with unacceptable replicate variance (results not shown).…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

The plasmids of Chlamydia trachomatis and Chlamydophila pneumoniae (N16): accurate determination of copy number and the paradoxical effect of plasmid-curing agents

et al. 2005

View full text Add to dashboard Cite

A 7?5 kbp cryptic plasmid is found in almost all isolates of Chlamydia trachomatis. Real-time PCR assays, using TaqMan chemistry, were set up to quantify accurately both the chlamydial plasmid and the single copy, chromosomal omcB gene in the infectious, elementary bodies (EBs) of C. trachomatis L1 440. Plasmid copy number was also determined in the EBs of six other lymphogranuloma venereum (LGV) isolates (serovars L1-L3), ten trachoma isolates (serovars A-C) and nine urogenital isolates (serovars D-J). The results indicated an average plasmid copy number of 4?0±0?8 (mean±95 % confidence interval) plasmids per chromosome. During the chlamydial developmental cycle, up to 7?6 plasmids per chromosome were detected, indicating an increased plasmid copy number in the actively replicating reticulate bodies. Attempts to eliminate the plasmid from strain L1 440 using the plasmid-curing agents ethidium bromide, acridine orange or imipramine/novobiocin led to a paradoxical increase in plasmid copy number. It is speculated that the stress induced by chemical curing agents may stimulate the activity of plasmid-encoded replication (Rep) proteins. In contrast to C. trachomatis, only a single isolate of Chlamydophila pneumoniae bears a plasmid. C. pneumoniae strain N16 supports a 7?4 kbp plasmid in which ORF1, encoding one of the putative Rep proteins, is disrupted by a deletion and split into two smaller ORFs. Similar assay techniques revealed 1?3±0?2 plasmids per chromosome (mean±95 % confidence interval) in EBs of this strain. These findings are in agreement with the hypothesis that the ORF1-encoded protein is involved in, but not essential for, plasmid replication and control of copy number. INTRODUCTIONMembers of the Chlamydiaceae are obligately intracellular, Gram-negative bacteria of significant importance in both human and animal pathogenesis. These organisms exhibit a unique developmental cycle, in which a metabolically active reticulate body (RB) gives rise to a dense, infectious elementary body (EB) (Rockey & Matsumoto, 2000). The family comprises two genera, Chlamydophila and Chlamydia (Everett et al., 1999), although this classification remains controversial (Schachter et al., 2001).Chlamydophila pneumoniae is an important human pathogen implicated in arterial disease (Saikku et al., 1992); infection of the respiratory tract causes an atypical pneumonia (Hahn et al., 2002). Although predominantly a human pathogen, C. pneumoniae strains have been isolated from animal species, e.g. equines (Everett et al., 1999;Storey et al., 1993; Wills et al., 1990) and koala (Wardrop et al., 1999).Chlamydia trachomatis is not only the major infectious agent of preventable blindness in the developing world (Thylefors et al., 1995), but also the commonest cause of non-specific urethritis in developed countries (Burstein & Zenilman, 1999). Sexually transmitted disease caused by C. trachomatis is frequently undiagnosed in women, whereupon an ascending infection may lead to pelvic inflammatory disease, salpingitis and consequent infe...

show abstract

Section: Discussionmentioning

confidence: 99%

“…Lysis of infected cells and/or chlamydiae was achieved by heating in the presence of ammonia using a modified method of Lanham et al (2001). Infected cells or purified EBs were centrifuged at 12 000 g for 10 min.…”

mentioning

confidence: 99%

The plasmids of Chlamydia trachomatis and Chlamydophila pneumoniae (N16): accurate determination of copy number and the paradoxical effect of plasmid-curing agents

et al. 2005

View full text Add to dashboard Cite

show abstract

“…PCR. Extracted DNA was tested for CMV (33,43), herpes simplex virus (HSV) (42), Bacteroides (66), Chlamydia (45), Gardnerella (40), Neisseria gonorrhoeae (29), Ureaplasma (32), group B Streptococcus (25), Mycoplasma hominis (32), and Mycoplasma genitalium (CCATGCTGAGAAGTAGAATAGC, TT GACATGCGCTTCCAATAA). An Applied Biosystems 9700HT sequence detection system (Foster City, Calif.) was used for real-time amplification of CMV and HSV sequences according to the manufacturer's instructions.…”

Section: Methodsmentioning

confidence: 99%

Human Cytomegalovirus Transmission from the Uterus tothe Placenta Correlates with the Presence of Pathogenic Bacteria andMaternalImmunity

Pereira

Maidji²,

McDonagh³

et al. 2003

J Virol

112

130

View full text Add to dashboard Cite

Prenatal cytomegalovirus infection may cause pregnancy complications such as intrauterine growth restriction and birth defects. How virus from the mother traverses the placenta is unknown. PCR analysis of biopsy specimens of the maternal-fetal interface revealed that DNA sequences from cytomegalovirus were commonly found with those of herpes simplex viruses and pathogenic bacteria. Cytomegalovirus DNA and infected cell proteins were found more often in the decidua than in the placenta, suggesting that the uterus functions as a reservoir for infection. In women with low neutralizing titers, cytomegalovirus replicated in diverse decidual cells and placental trophoblasts and capillaries. In women with intermediate to high neutralizing titers, decidual infection was suppressed and the placenta was spared. Overall, cytomegalovirus virions and maternal immunoglobulin G were detected in syncytiotrophoblasts, villus core macrophages, and dendritic cells. These results suggest that the outcome of cytomegalovirus infection depends on the presence of other pathogens and coordinated immune responses to viral replication at the maternal-fetal interface.

show abstract

“…the advocates of the 'hit-and-run' theory of infection believe that HpV or herpesviruses is a transformation-initiating factor, and they explain problems with direct detection of this infection in carcinoma cells as being due to elimination of viral DnA in the course of oncogenesis (41). However, prolonged and persistent infection is more important than spontaneous infection.…”

Section: Discussionmentioning

confidence: 99%

Prevalence and association of human papillomavirus 16, Epstein-Barr virus, herpes simplex virus-1 and cytomegalovirus infection with human esophageal carcinoma: A case-control study

Zhang

Zhang²,

Hong³

et al. 2011

Oncol Rep

View full text Add to dashboard Cite

Abstract. recent research shows esophageal carcinoma (ec) as the ninth most common malignancy in the world. the association of viral infection and ec has been reported in the last 30 years. However, geographic variation in infection rates and the key mechanisms of the viral action have yet to be resolved. this study aimed to determine the prevalence and association of human papillomavirus 16 (HpV-16), herpes simplex virus 1 (HsV-1), epstein-Barr virus (eBV) and cytomegalovirus (cMV) infection in the etiology of ec in the area of shantou, guangdong, china. nested pcr was used to detect viral DnA in the mucosa of 70 cases of ec and in paracancerous tissues, as well as 100 cases of normal esophagus mucosa. Data were analyzed by χ 2 test, Fisher's exact test and bivariate correlation analysis. the infection rates of HpV-16, HsV-1 and eBV were 40.0, 30.0 and 30.0%, respectively, in ec mucosa, and were significantly higher than those in normal mucosa. However, no cMV DnA was detected in either ec or normal mucosa. HpV-16 or eBV infection was mainly detected in ec patients 48-58 years old, and the infection rate was positively associated with pathological grade of ec (p<0.05). tobacco smoking and alcohol consuption were high risk factors for HpV-16 infection for male patients [odds ratio (OR), 5.9; 95% confidence interval (CI), 1.4-24.6; OR=3.8; 95% CI, 1.1-13.8]. Rates of infection with a mixture of these 3 viruses were all more than 10.0% in cancerous mucosa and closely related to the pathological grade of EC (P=0.001). Infection with HPV-16, HSV-1 or EBV may be an important etiological factor in ec.

show abstract

Detection of Cervical Infections in Colposcopy Clinic Patients

Cited by 21 publications

References 24 publications

The plasmids of Chlamydia trachomatis and Chlamydophila pneumoniae (N16): accurate determination of copy number and the paradoxical effect of plasmid-curing agents

The plasmids of Chlamydia trachomatis and Chlamydophila pneumoniae (N16): accurate determination of copy number and the paradoxical effect of plasmid-curing agents

Human Cytomegalovirus Transmission from the Uterus tothe Placenta Correlates with the Presence of Pathogenic Bacteria andMaternalImmunity

Prevalence and association of human papillomavirus 16, Epstein-Barr virus, herpes simplex virus-1 and cytomegalovirus infection with human esophageal carcinoma: A case-control study

Contact Info

Product

Resources

About