Detection of bovine leukaemia virus (BLV) infection by DNA probe technology

Gaudi, Simona; Ponti, W.; Agresti, A; Meneveri, Raffaella; Malcovati, Massimo; Bonizzi, L.; Poli, G.; Amato, Aldo; Ginelli, Enrico

doi:10.1016/0890-8508(90)90050-a

Cited by 7 publications

(5 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This analysis mapped the env gene in the 2 kb BamHI fragment, whereas the pol gene was contained in both the 2.2 and 1 kb fragments (not shown). The derived map was different from those of BLV-I1 and other previously characterized variants such as the Belgian, American, Australian and Japanese strains (not shown; COULSTON et al, 1990;GAUDI et al, 1990).…”

Section: Resultscontrasting

confidence: 73%

“…The env gene is contained in the small fragment, whereas the large fragment contains the pol gene. In general, this BamHI map resembles that of the Japanese isolate (GAUDI et al, 1990). The sequencing also showed that the BLV-I2 proviral D N A has an additional BamHI site within the pol gene, which splits the 3.2 kb fragment into two subfragments approximately 2.2 and 1 kb in length; this feature is only shared by the Australian isolate (COULSTON et al, 1990).…”

Section: Discussionmentioning

confidence: 74%

“…High-molecular-weight bovine genomic DNA was extracted from Ficoll-Paque purified lymphocytes using the SDS-Proteinase K method, digested with restriction endonucleases, fractionated by agarose gel electrophoresis and hybridized to a radiolabelled pBLV probe, as previously described by GAUDI et al (1990). The pBLV DNA plasmid came from Belgium and contained an 8.3 kb Sac1 DNA fragment, which is representative of the Belgian isolate.…”

Section: N a Analysis B Y Southern-blot Hybridizationmentioning

confidence: 99%

See 2 more Smart Citations

Molecular Characterization of a Variant of Proviral Bovine Leukaemia Virus (BLV)

Molteni

Agresti

Meneveri

et al. 1996

Journal of Veterinary Medicine, Series B

View full text Add to dashboard Cite

Summary Southern‐blot hybridization and partial sequencing of the pol and env genes were used to characterize BLV‐integrated provirus of seropositive cattle from two dairy herds in northern Italy. Comparison of the data obtained with those of previously characterized BLV strains from other geographic areas (Australia, Belgium, Japan and USA) revealed the presence of a viral variant (BLV‐I2), which showed both conserved and unique features. Regarding the gp51 envelope glycoprotein, the BLV‐I2 variant showed: 1. A high extent of conservation, which included potential glycosylation sites and cysteine residues; 2. Three unique amino acid residues not present in any of the other BLV strains analysed; and 3. Some variability at the level of one (G) of the three (F, G and H) conformational epitopes, which is probably important in the process of infection. These results agree with the suggestion that the sequence variability of the gp51 glycoprotein preferentially involves structures whose change is thought to underlie the phenomenon of escape from immune surveillance.

show abstract

Section: Resultscontrasting

confidence: 73%

Section: Discussionmentioning

confidence: 74%

Section: N a Analysis B Y Southern-blot Hybridizationmentioning

confidence: 99%

See 1 more Smart Citation

Molecular Characterization of a Variant of Proviral Bovine Leukaemia Virus (BLV)

Molteni

Agresti

Meneveri

et al. 1996

Journal of Veterinary Medicine, Series B

View full text Add to dashboard Cite

show abstract

“…BLV env insert (nucleotides 5131–6158) was amplified by polymerase chain reaction (PCR) from pGEM‐1224 plasmid [7]by means of two synthetic oligonucleotides: SP6 (Promega) and a specific BLV env (6158‐CCGATTATCCTTATCCGAATCTTGTTC‐6131) primer. Amplified DNA, cut by Nco I‐ Hin dIII restriction endonucleases (1100 bp), was cloned in pBlueBacHis‐B shuttle vector, downstream the polh promoter cassette.…”

Section: Methodsmentioning

confidence: 99%

“…BLV envelope proteins can elicit a strong and long‐lasting immune response in infected cattle [4]. Indeed, earliest phases of BLV infection can be diagnosed by serological techniques, based on gp51 antibody detection [6], as well as by molecular techniques, using DNA probe hybridization [7]and in vitro amplification of viral genome sequences [8, 9]. Moreover, gp51 was also used to produce vaccines against BLV infection.…”

Section: Introductionmentioning

confidence: 99%

Expression of bovine leukemia virus ENV glycoprotein in insect cells by recombinant baculovirus

Russo¹,

Montermini

Berkovitz-Siman-Tov

et al. 1998

FEBS Letters

Self Cite

View full text Add to dashboard Cite

The gp51-p30 glycoprotein constituting BLV envelope was expressed in Sf-21 insect cells by means of recombinant baculoviruses. Post-infection cell lysates were analyzed, in order to define the immunologic reactivity of recombinant products. Oligosaccharide chains, containing N-acetylglucosamine, mannose, galactose and sialic acid were found on recombinant gp51-p30. In order to investigate the timing of transcription and translation of the glycoprotein, kinetic assays were carried out on cell lysates and directly in situ on Sf-21 cells during the course of baculovirus infection. The use of different solubilizing reagents was also evaluated in order to rescue recombinant glycoprotein from its subcellular location.z 1998 Federation of European Biochemical Societies.

show abstract