Detection of Amantadine-Resistant Influenza A Virus Strains in Nursing Homes by PCR-Restriction Fragment Length Polymorphism Analysis with Nasopharyngeal Swabs

Abstract

Annual consumption of amantadine increased abruptly after its approval for the treatment of influenza A virus infections in Japan in 1998, and the emergence of amantadine-resistant viruses is now a matter of concern. To detect resistant influenza A virus strains, we have developed a PCR-restriction fragment length polymorphism (PCR-RFLP) analysis for nasopharyngeal swabs. Three different primer sets for nested PCR were designed to incorporate restriction sites into the amplicon to differentiate single-amino-acid substitutions at positions 27, 30, and 31 that confer resistance in the transmembrane domain of the M2 protein. Each PCR product was digested with respective endonucleases (BspLU11I for amino acid change at position 27, HhaI for position 30, and ScaI for position 31), and the polymorphisms were determined by electrophoresis. Thirty-four (24.1%) of 141 PCR-positive samples had resistance patterns in eight nursing homes in the 1998-1999 season. Thirty-one viruses (91.2%) showed a change at position 31 (serine to asparagine), three viruses (8.8%) showed a change at position 30 (alanine to threonine), and none showed a change at position 27. The incidence of resistant viruses did not show any significant difference between four facilities where amantadine was used mainly for influenza treatment and four other facilities where it was used only for Parkinson's disease, values being 27.6 and 16.3%, respectively. We have confirmed that the PCR-RFLP method is useful for detecting amantadine-resistant strains directly from nasopharyngeal swabs and that resistant viruses were circulating in nursing homes where the drug was used not only for influenza virus but also for Parkinson's disease.

An Off-Seasonal Amantadine-Resistant H3N2 Influenza Outbreak in Japan

“…The genetic basis for resistance to these drugs is associated with amino acid substitutions at positions 26, 27, 30, 31 or 34 in the transmembrane region of the M2 protein (Pinto et al 1992;Holsinger et al 1994). It was reported that roughly 1/3 of patients develops resistance after treatment (Hayden and Hay 1992;Saito et al 2002), but resistance in pre-treatment samples, or community prevalence, remained low in the past, as 0-3% in Japan (Suzuki et al 2001(Suzuki et al , 2003, and roughly 1% in the United States and the United Kingdom (Ziegler et al 1999;Tooley 2002). However, Bight and colleagues (Bright et al 2005(Bright et al , 2006 recently highlighted a dramatic increase in the prevalence of amantadine resistant H3N2 influenza strains in Asian countries and USA.…”

Antiviral resistance in influenza viruses circulating in Central and South America based on the detection of established genetic markers

“…Nucleic acid was extracted with the use of viral RNA kit (QIAamp, Qiagen ® , Valencia, CA ) and tested by reverse‐transcriptase‐polymerase‐chain reaction (RT‐PCR). Neuraminidase and matrix protein 2 genes were amplified by RT‐PCR with the following specific primers: bases 617–995 (338 pdb fragment) of the influenza A matrix protein 2, M2‐For3 (5′‐CTAGTCAGGCCAGGCAAATG‐3′) and M2‐Rev (5′‐ACTGTCGTCAGCATCCACAG‐3′); 21 bases 449–1218 (769 pdb fragment) of the influenza A neuraminidase 1, AN1A (5′‐AGGACAGAAGCCCTTATAGG‐3′) and AN1DII (5′‐TTAGCTCAGGATGTTGAACG ‐3′); bases 299–997 (698 pdb fragment) of the influenza A neuraminidase 2, AN2A (5′‐ATTACAGGATTTGCACCTTT‐3′) and H3N2‐NA‐2R (5′‐GGGTGTGTCTCCAACAAGTCTGAGCAC‐3′); bases 352–641 (289 pdb fragment) of the influenza B neuraminidase, NA‐RES‐F (5′‐GCTCTAACCCATTATGCAG‐3′) and NA‐RES‐R (5′‐CTTTCTTGTGTTCTTAGGATG‐3′).…”

Búsqueda de resistencia a amantadina en cepas de virus influenza A aisladas en Santiago de Chile, entre los años 2001 y 2002

“…Este fenómeno se ha observado principalmente en comunidades cerradas como son los asilos de ancianos e instituciones de salud [9][10] . Respecto a la frecuencia de adquisición de esta resistencia, distintos estudios muestran resultados muy variables: desde 10 a 30% en algunas series 6,9,11-13 a 1,5 y 3,4% en otras [10][11][12][13][14] . La generación de resistencia ocurre entre los 2 y 7 días de iniciado el tratamiento habiéndose documentado propagación de virus resistentes entre los contactos cercanos 6,13 .…”

“…La adquisición de resistencia se debe a mutaciones en los genes que codifican para los aminoácidos constituyentes del dominio transmembrana de la proteína M2. Estas mutaciones ocurren en las posiciones 26, 27, 30 y 31, siendo esta última la más frecuente ya que da cuenta de 70 a 80% de los casos 12 . La metodología tradicional para la detección de cepas resistentes en el laboratorio es compleja y consiste en demostrar la pérdida de la capacidad de inhibir cultivos celulares en presencia de amantadina 15 .…”

“…Procedimientos más modernos incluyen amplificación mediante RPC, clonación y secuenciación del material genético que codifica a la proteína M2 en cepas de virus FLU expuestos a amantadina 16,17 . Otra metodología para determinar la presencia de estas mutaciones es el análisis de los tamaños de fragmentos que codifican para la proteína M2, amplificados por RPC y procesados con enzimas de restricción 12,18 . En nuestro medio no se ha reportado la existencia de cepas de virus FLU A resistentes a amantadina.…”