Detection and quantification of <i>Phytophthora</i> species which are associated with root‐rot diseases in European deciduous forests by species‐specific polymerase chain reaction

Schubert, Roland; Bahnweg, G.; Nechwatal, Jan; Jung, T.; Cooke, D. E. L.; Duncan, J. M.; Müller‐Starck, G.; Langebartels, Christian; Sandermann, Heinrich; Oßwald, Wolfgang

doi:10.1046/j.1439-0329.1999.00141.x

Cited by 62 publications

(53 citation statements)

References 37 publications

(27 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Then, the PCR amplification with species-specific designed primer amplifies a PCR product of 380 bp as specific for Colletotrichum gloeosporioides. Similarly, the existence of species-specific primers require the presence of viable organisms and can work even when there is a limited amount of sample [23]. In the present investigation, a sensitive PCR-based diagnostic assay were developed with the aim to detect Colletotrichum gloeosporioides mango anthracnose pathogen in infected plant and fruit tissue using species-specific designed primerpair.…”

Section: Pcr Amplification Of Species-specific Designed Primermentioning

confidence: 99%

A Species-Specific PCR Based Assay for Rapid Detection of Mango Anthracnose Pathogen Colletotrichum gloeosporioides Penz. and Sacc

Kamle¹

2013

J Plant Pathol Microb

View full text Add to dashboard Cite

Mango (Mangifera indica L.) a fruit of nutraceutical value is accepted as the most eatable fruit crop worldwide. Mango production has been severely affected by several biotic stress mainly diseases and anthracnose is the major post-harvest disease of mango results in heavy losses. The present investigation describes PCR based assay for rapid and sensitive detection of Colletotrichum gloeosporioides causing mango anthracnose. Genus specific universal primer pair ITS1 and ITS4 was employed to amplify Colletotrichum genus which shows ‫065ﮧ‬ bp amplicon. The Colletotrichum gloeosporioides species-specific sequences for conserved domains were retrieved from the NCBI Genbank (sequence HM10205) and specific primers were designed. In order to validate the speciesspecific designed primer, a sensitive nested PCR assay was carried out using designed primer-pair MKCgF 5` TTGCTTCGGCGGGTAGGGTC 3` (forward) and MKCgR 3`ACGCAAAGGAGGCTCCGGGA 5` (reverse) produced an amplicon size of 380 bp as specific. Our investigation revealed that C. gloeosporioides causal agent of mango anthracnose was discriminated on the basis of species as specific for mango in comparison to other Colletotrichum spp. viz. C. acutatum, C. falcatum and C. capsici causing anthracnose in other crops.

show abstract

Section: Pcr Amplification Of Species-specific Designed Primermentioning

confidence: 99%

A Species-Specific PCR Based Assay for Rapid Detection of Mango Anthracnose Pathogen Colletotrichum gloeosporioides Penz. and Sacc

Kamle¹

2013

J Plant Pathol Microb

View full text Add to dashboard Cite

show abstract

“…The variability in the DNA regions of ITS regions of rRNA of Phytophthora spp. has been also examined by Schubert et al [21] and Boersma et al [5]; thus, it became possible to discriminate species within the Phytophthora genus using species-specific primers designed by those authors. Because of recent changes in the P. citricola complex-the new species P. plurivora sp.…”

Section: Phytophthora Spp Identification In Pcr Assaysmentioning

confidence: 99%

Identification of Phytophthora spp. isolated from plants and soil samples on strawberry plantations in Poland

Meszka

Michalecka

2016

J Plant Dis Prot

View full text Add to dashboard Cite

Crown and leather rot of strawberry caused by Phytophthora spp. are major soil diseases of cultivated strawberry (Fragaria 9 ananassa) in Poland. In this study, in total 45 isolates of Phytophthora spp. from plants of cultivars Elsanta, Honeoye, Florence, Camarosa, Roxana, Onebor, Alba, Elegance, Albion, Senga Sengana and Malwina originating from crowns (20 isolates) and fruits (25 isolates) as well as 25 soil samples from the same fruiting strawberry plantations located in central, northeastern, and south-eastern regions of Poland were identified. Among them, 44 isolates from plant organs and eight from soil samples were identified as Phytophthora cactorum and from one plant and one soil sample as P. citricola; of those remaining from the soil, one was identified as P. citrophthora and one as P. cryptogea. Identifications were based on morphological characteristics and DNA analyses. Species-specific polymerase chain reaction confirmed the presence of Phytophthora spp. in all positive examined plant and soil samples and confirmed that P. cactorum is predominantly responsible for crown and leather rot diseases of strawberry in monitored regions of Poland. Pathogenicity tests showed that all isolates of Phytophthora spp. originating from soil derived from strawberry plantations were pathogenic both to strawberry and to raspberry.

show abstract

“…alder dieback in Europe (P. alni C. Brasier & S.A. Kirk, P. polonica M. Belbahri, E. Moralejo & F. Lefort) (Brasier et al 2004a, Belbahri et al 2006 Greslebin et al 2007) and Australia (P. (Jung et al 1999, Werres et al 2001, Jung et al 2002, Rizzo et al 2002, Jung et al 2003, Reeser et al 2007, Jung & Nechwatal 2008, Scott et al 2009, Rea et al 2010, Crous et al 2011, Reeser et al 2011 (Maseko et al 2007, Bezuidenhout et al 2010). …”

Section: New Species Of Phytophthora In Nurseries and Natural Ecosystemsmentioning

confidence: 99%

“…These facts make ITS highly useful for molecular discrimination, especially ITS1, because the sequence is already available for almost all Phytophthora species. However, some closely related species can share identical sequences (Schubert et al 1999, Brasier et al 2004a, Jung & Burgess 2009, Bezuidenhout et al 2010). Other multicopy targets are mitochondrial genes, of which the cytochrome oxidase I (cox) gene has been used for detection of P. ramorum in addition to some other species (Martin et al 2004, Tooley et al 2006.…”

Section: Detecting and Identifying Phytophthoramentioning

confidence: 99%

“…However, an important disadvantage of using the PCR-DGGE method developed here relates to the sequence diversity of the region. Difficulties in separating Phytophthora species arise when dealing with closely related species which can share identical or almost identical ITS sequence (II) (Schubert et al 1999, Hansen et al 2003, Brasier et al 2004a, Martin & Tooley 2003, Jung & Burgess 2009, Bezuidenhout 2010). In such cases, species can be identified by sequence analyses of single bands, provided that databases including all alleles are available.…”

Section: Detection and Identification Of Phytophthora Spp With Pcr-dggementioning

confidence: 99%

See 1 more Smart Citation

Phytophthora in Finnish nurseries

Rytkönen¹

2011

Diss. For.

View full text Add to dashboard Cite

International trade and travel have facilitated the spread of harmful organisms around the world. Human-mediated movement of plants and plant products is now generally accepted to be the primary mode of introduction of pathogens and pests. Species of Phytophthora, a genus of plant pathogens, are commonly spread in this way and have caused severe epidemics in silviculture, horticulture and natural systems all over the world.The objective of the study was to gather information on the occurrence of Phytophthora spp. in Finnish nurseries. Furthermore, the aim was to produce information for risk assessments for these Phytophthora spp. and establish molecular means for their detection. Phytophthora cactorum was found to persist in natural waterbodies and results suggest that irrigation water might be a source of inoculum for the disease in nurseries. In addition to P. cactorum, isolates from ornamental Rhododendron in nurseries yielded three species new to Finland: P. ramorum, P. plurivora and P. pini. The only species with quarantine status, P. ramorum, was able to persist in the nursery in spite of an annual European Commission sanitation protocol. Phytophthora plurivora and the closely related P. pini had more hosts among Nordic tree species and other plants abundant in Finnish nurseries and forest ecosystems. They were also found to have higher infectivity rates compared to P. ramorum and P. cactorum. All four species survived two weeks in -5 °C , and thus soil survival of these Phytophthoras in Finland is likely under current climatic conditions.The most common tree species in Finnish nurseries, Picea abies, was highly susceptible to P. plurivora and P. pini in pathogenicity trials. In a histological examination of P. abies shoot tissues inoculated with P. plurivora zoospores, fast necrotrophic growth was observed in nearly all tissues of the fresh shoot. The production of propagules in P. abies shoot tissue was only weakly indicated.In this study, a PCR-DGGE technique was developed for simultaneous detection and identification of Phytophthora spp. It reliably detected Phytophthora in plant tissues and could discriminate most test species as well as indicate instances of multiple-species infections. It proved to be a useful detection and identification tool either applied alone or in concert with traditional isolation culture techniques. The limitations of the method are also discussed.In conclusion, all of the introduced species of Phytophthora had properties that promote a high risk of establishment and spread in Finland. The efficient transport of Phytophthora via commercial traffic and favorable conditions due to expected climate change will increase the incidence and establishment of Phytophthora in new areas. Thus, it is probable that pathogens of this genus will be introduced and become established in Finland and other Nordic countries unless efficient phytosanitary control becomes standard practice in the international plant trade.Keywords: Phytophthora, pathogenicity, survival, molecular detectio...

show abstract

Detection and quantification of Phytophthora species which are associated with root‐rot diseases in European deciduous forests by species‐specific polymerase chain reaction

Cited by 62 publications

References 37 publications

A Species-Specific PCR Based Assay for Rapid Detection of Mango Anthracnose Pathogen Colletotrichum gloeosporioides Penz. and Sacc

A Species-Specific PCR Based Assay for Rapid Detection of Mango Anthracnose Pathogen Colletotrichum gloeosporioides Penz. and Sacc

Identification of Phytophthora spp. isolated from plants and soil samples on strawberry plantations in Poland

Phytophthora in Finnish nurseries

Contact Info

Product

Resources

About