Detection and prediction of post harvest carrot diseases

Abstract

Specific PCR primers were developed for identifying two post harvest pathogens, Mycocentrospora acerina and Fibularhizoctonia carotae, which cause liquorice rot and crater rot respectively, during prolonged low temperature storage of carrots. The methods allow routine detection of less than 0.3 pg of M. acerina DNA and less than 0.03 pg F. carotae DNA, even in the presence of large excess of plant or soil DNA. Standard PCR and quantitative PCR gave similar results and either method could be used in a practical situation. Experiments were carried out testing these methods on different types of carrot tissue-and soil-samples. Soil was sampled before sowing, and soil adhering to the roots or root tissue was sampled at different times during the growing season or at harvest. Soil adhering to the carrots at harvest had the best predictive ability for liquorice rot development during storage (R 2 predicted 74.9% using standard PCR), but samples taken during the growing season also gave reasonably good predictive ability values. PCR data from soil samples taken in the spring were not as good as a predictor for this disease. A dense sampling strategy using 20 m between sampling points generally gave better correlation between PCR data and disease data than using 40 m between the sampling points. Use of the developed methods in an IPM strategy for liquorice rot is discussed. For crater rot the correlation between PCR data and disease data was generally poor for all types of samples. These results are discussed in relation to the biology of F. carotae.

Changes in the prevalence of fungal species causing post‐harvest diseases of carrot in Finland

“…are considered to cause pits and cavities on parsnip (Channon & Thomson, 1981) and potato (Choiseul et al, 2006), they may also have a role in the symptom development on carrot. Alternaria radicina , Athelia arachnoidea or Rhexocercosporidium carotae species, found causing pit symptoms in carrot in other countries in Europe (Årsvoll, 1969; Hermansen et al, 2012; Kastelein et al, 2007; Snowdon, 1992), were not detected in the samples from Finland. No symptoms characteristic of carrot infection by Berkeleyomyces spp.…”

“…The DNA samples were tested for the presence of M. acerina, F. avenaceum and B. cinerea by single PCR reactions using speciesspecific primers. The primers were KLO15F (CGGTCGGACTCCATT CAAAC) and KLO20R (GCTCCGAAGCAAGTACGCCG) for M. acerina (Hermansen et al, 2012), FA-F1 (AACATACCTTAATGTTGCCTCGG) and FA-R1 (ATCCCCAACACCAAACCCGAG) for F. avenaceum (Mishra et al, 2003), and Bc-F (CAGGAAACACTTTTGGGGATA) and Bc-R (GAGGGACAAGAAAATCGACTAA) for B. cinerea (Fan et al, 2015). The sizes of the expected PCR products were 314 bp, The PCR products were analysed by electrophoresis on 1.5% agarose gels in Tris-borate-EDTA buffer.…”

“…In Northern Europe, liquorice rot is one of the major post‐harvest diseases of carrot (Hermansen et al, 2012). This disease is mainly caused by Mycocentrospora acerina , although other fungal species in the genera Fusarium and Alternaria can cause similar symptoms (Mohamad, 2021).…”

“…The majority of visible damages appearing during a long cold storage are caused by fungal pathogens. In the Netherlands Rhexocercosporidium carotae causing significant pit disease problems was reported (Kastelein et al, 2007), and in Norway Athelia arachnoidea (synonyms Rhizoctonia carotae , Fibulorhizoctonia carotae ), causing crater rot, was reported as an important post‐harvest pathogen (Hermansen et al, 2012). Alternaria radicina is a seedborne pathogen that occurs in most carrot production areas of the world and causes black rot, appearing as dark pits and cavities (Davis & Raid, 2002; Farrar et al, 2004; Kastelein et al, 2007; Papoutsis & Edelenbos, 2021).…”

The nest fungus of the lower termite Reticulitermes labralis

“…We identified that the brown balls in egg piles of R. labralis were the sclerotia of Fibulorhizoctonia sp. Fibulorhizoctonia is a genus of fungi in the Atheliaceae family, and three widespread species have been named, F. carotae , F. centrifuga and F. psychrophila , which were consistently isolated from decayed fruits, vegetables and wooden storage bins 1,7,8 . Most fungi produce some type of durable microscopic structure such as a spore that is important for dispersal and/or survival under adverse conditions.…”