Detection and molecular characterization of an aster yellows phytoplasma in parsley

Khadhair, A. H.; Kawchuk, L. M.; Taillon, R.C.; Botar, G.

doi:10.1080/07060669809500445

Cited by 20 publications

(18 citation statements)

References 22 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To prepare the multilocus P. infestans specific RFLP probe RG57, a genomic DNA fragment was amplified by polymerase chain reaction (PCR) from P. infestans US-11 using the primers RG57P1F (5ʹACCATGCAGCTGAATTGCCAT3ʹ) and RG57P1R (5ʹCTCTCATAACCGACGTTTTC3ʹ) that are specific to the RG57 sequence (GenBank Accession AF495861) (Goodwin et al 1992). The PCR was performed in 100 μL of 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl 2 , 0.001% gelatin, 0.25 mM of each dNTP, 2 μM of each primer, 0.5 U Vent Taq DNA polymerase (New England Biolabs, Inc., Mississauga, ON) and 200 ng template DNA as previously described (Khadhair et al 1998;Entz et al 2005). The PCR product was used as a template for random labelling with 32 P. Blotting of the digest on the Nytran SPC membranes, hybridization and post-hybridization washing were performed as recommended by the membrane manufacture (GE Healthcare, Baie d'Urfe, QC).…”

Section: Isolate Characterizationmentioning

confidence: 99%

Characterization ofPhytophthora infestanspopulation diversity in Canada reveals increased migration and genotype recombination

Peters

Al-Mughrabi

Kalischuk

et al. 2014

Canadian Journal of Plant Pathology

Self Cite

View full text Add to dashboard Cite

Section: Isolate Characterizationmentioning

confidence: 99%

Characterization ofPhytophthora infestanspopulation diversity in Canada reveals increased migration and genotype recombination

Peters

Al-Mughrabi

Kalischuk

et al. 2014

Canadian Journal of Plant Pathology

Self Cite

View full text Add to dashboard Cite

“…Several universal and group-specifi c primers have been designed for the detection of phytoplasma by the past researchers (Lee et al 1993 ;Lorenz et al 1995 ;Smart et al 1996 ;Gundersen and Lee 1996 ;Khadhair et al 1998 ;Berges et al 2000 ). The nested-PCR assay using the groupspecifi c primers was the most sensitive and specifi c technique for the detection of the phytoplasma.…”

Section: Pcr/rflp Assays and Phylogenetic Relationshipsmentioning

confidence: 98%

Occurrence, Distribution, and Molecular Identification of Phytoplasma-associated Diseases in Ornamental Plants

Khan¹,

Ahmad²,

Akhtar³

2016

Plant, Soil and Microbes

View full text Add to dashboard Cite

Phytoplasma is recognized as the serious constraints for the many economically ornamental plants all around the world. It may reduce the quality and yield of ornamental plants and is recognized internationally because of its unspecifi c symptoms, severe losses, and diverse epidemiology. The epidemics of these diseases have compelled the withdrawal of many ornamental plant species such as gladiolus, lily, chrysanthemum, and rose from cultivation. So far, more than 42 ornamental plant species were reported as infected by phytoplasma. The general symptom includes fl ower malformation, growth abnormalities, yellowing or decline of leaves, elongation and etiolation of internodes, witches' broom, stunting, little leaf, and virescence. The knowledge on the diversity and identifi cation of phytoplasma has been explored with the molecular tools and techniques showing that phytoplasma infecting the ornamental plant Candidatus Phytoplasma asteris belongs to a major 16Srl group. The other known groups of phytoplasmas are 16Srll, 16Srlll, 16SrV, 16SrVl, 16SrVll, 16SrlX, 16SrX, 16SrXll, 16SrXlll, and 16SrXV. For the detection of phytoplasma in the infected plant parts or tissues, the 16S rRNA gene fragments were amplifi ed using phytoplasma universal primer pairs P1/P7 in a polymerase chain reaction (PCR) followed by primer pairs R16F2n/R16R2 in the nested PCR. Nevertheless, for the fi ner detection of phytoplasma-related Candidatus Phytoplasma asteris, DNA samples were used to extend the RP and Tuf gene fragments by PCR using aster yellows group-specifi c primer pairs RP(l)F1A/RP(l)R1A and fTufAy/rTufAy, respectively. However, the restriction fragment length polymorphism (RFLP) analysis of RP gene fragments digested with Alul, Msel, and Tsp5091 restriction enzymes indicates the presence of aster yellows group. The aim of the present chapter is to provide an overview of the phytoplasma-associated diseases in ornamental plants, their mode of transmission, and the molecular techniques employed to detect the phytoplasma in the infected plant parts or tissues.

show abstract

“…Phytoplasmas are transmitted by highly mobile and phloemfeeding insects, primarily Macrosteles fascifrons Stal., leafhoppers (Chiykowski 1991). Yellows-type diseases have been commonly found associated with several plant species in western Canada (Chang et al 1995(Chang et al , 1996Hwang et al 1997;Khadhair and Evans 2000;Khadhair et al 1997aKhadhair et al , 1997bKhadhair et al , 1997cKhadhair et al , 1998Khadhair et al , 2001Wang and Hiruki 2001). Based on phylogenetic relationships, these phytoplasmas were found to belong to the aster yellows (AY) and clover proliferation phytoplasma groups (Wang and Hiruki 2001;Khadhair and Hiruki 1995;Khadhair et al 1998).…”

Section: Introductionmentioning

confidence: 94%

“…Yellows-type diseases have been commonly found associated with several plant species in western Canada (Chang et al 1995(Chang et al , 1996Hwang et al 1997;Khadhair and Evans 2000;Khadhair et al 1997aKhadhair et al , 1997bKhadhair et al , 1997cKhadhair et al , 1998Khadhair et al , 2001Wang and Hiruki 2001). Based on phylogenetic relationships, these phytoplasmas were found to belong to the aster yellows (AY) and clover proliferation phytoplasma groups (Wang and Hiruki 2001;Khadhair and Hiruki 1995;Khadhair et al 1998). Aster yellows seems to be the most comprehensively reported prokaryotic disease associated with various plant species worldwide (Ceranic-Zagorac and Hiruki 1996;Howard et al 1994;Kuske and Kirkpatrick 1992;Schneider et al 1993).…”

Section: Introductionmentioning

confidence: 94%

Incidence and molecular detection of yellows-type disease in carrots, associated with leafhoppers in southern Manitoba, Canada

Wally

Daayf

Khadhair

et al. 2004

Canadian Journal of Plant Pathology

View full text Add to dashboard Cite

Aster yellows (AY), a disease caused by phytoplasmas, is a limiting factor to carrot production in Manitoba, Canada. The pathogen is transmitted by insect vectors, Macrosteles fascifrons (leafhoppers), and causes serious losses in many other crops. Traditional methods for estimating AY incidence in carrots and the proportion of AY-vector insects are based on visual symptoms and on bioassays of leafhopper populations. In the present study, techniques based on polymerase chain reaction (PCR) were adapted for the examination of insect and carrot tissues. A more accurate determination of infected plants and of virulent leafhoppers was achieved over two growing seasons. Surveys were carried out in five carrot fields in southern Manitoba throughout the 2001 and 2002 growing seasons. Large numbers of leafhoppers were captured weekly, and both direct and nested PCR were performed on individual samples in a population of more than 1000 insects and on 250 carrot samples as well as on several potential hosts around the carrot fields. According to PCR testing, visual assessments appear to overestimate the true incidence of AY in carrots. The percentage of leafhoppers carrying phytoplasma differed between the two years (18% and 31% in 2001 and 2002, respectively). However, higher proportions of leafhoppers carrying phytoplasmas were found early in the growing season in both study years. Therefore, implementation of management decisions would be more valuable early in the season, when the presence of the first leafhoppers is confirmed. 505Résumé : La jaunisse de l'aster (JA), causée par un phytoplasme, est un facteur limitant pour la culture de la carotte au Manitoba, Canada. L'agent pathogène est transmis par des insectes vecteurs, le Macrosteles fascifrons (cicadelles), et est responsable de pertes importantes chez plusieurs autres cultures. Les méthodes classiques pour évaluer la fréquence de la maladie chez la carotte et la proportion d'insectes qui sont vecteurs de la JA sont basées sur des symptômes visibles à l'oeil nu et sur des bioessais avec les populations de cicadelles. Dans la présente étude, des techniques axées sur la réaction en chaîne de la polymérase ont été adaptées pour permettre l'examen d'insectes et de tissus de carotte. Une évaluation plus précise des plantes infectées et des cicadelles virulentes a été effectuée au cours de deux saisons de croissance. Les inventaires ont été effectués dans cinq champs de carotte du sud du Manitoba au cours des saisons 2001 et 2002. De grandes quantités de cicadelles ont été capturées à chaque semaine, et la PCR directe et la PCR nichée ont été utilisées sur des échantillons individuels dans une population de plus de 1000 insectes et sur 250 échantillons de carotte, de même que sur plusieurs hôtes potentiels présents à proximité des champs de carotte. Selon les tests avec la réaction en chaîne de la polymérase, l'évaluation visuelle de la JA chez la carotte semble surestimer la véritable fréquence de la maladie. Le pourcentage de cicadelles vectrices du phytoplasme a ét...

show abstract

Detection and molecular characterization of an aster yellows phytoplasma in parsley

Cited by 20 publications

References 22 publications

Characterization ofPhytophthora infestanspopulation diversity in Canada reveals increased migration and genotype recombination

Characterization ofPhytophthora infestanspopulation diversity in Canada reveals increased migration and genotype recombination

Occurrence, Distribution, and Molecular Identification of Phytoplasma-associated Diseases in Ornamental Plants

Incidence and molecular detection of yellows-type disease in carrots, associated with leafhoppers in southern Manitoba, Canada

Contact Info

Product

Resources

About