Designer Receptors for Nucleotide‐Resolution Analysis of Genomic 5‐Methylcytosine by Cellular Imaging

Abstract

We report programmable receptors for the imaging‐based analysis of 5‐methylcytosine (5mC) in user‐defined DNA sequences of single cells. Using fluorescent transcription‐activator‐like effectors (TALEs) that can recognize sequences of canonical and epigenetic nucleobases through selective repeats, we imaged cellular SATIII DNA, the origin of nuclear stress bodies (nSB). We achieve high nucleobase selectivity of natural repeats in imaging and demonstrate universal nucleobase binding by an engineered repeat. We use TALE pairs differing in only one such repeat in co‐stains to detect 5mC in SATIII sequences with nucleotide resolution independently of differences in target accessibility. Further, we directly correlate the presence of heat shock factor 1 with 5mC at its recognition sequence, revealing a potential function of 5mC in its recruitment as initial step of nSB formation. This opens a new avenue for studying 5mC functions in chromatin regulation in situ with nucleotide, locus, and cell resolution.

Engineered TALE Repeats for Enhanced Imaging‐Based Analysis of Cellular 5‐Methylcytosine

“…To enable imaging‐based in situ analysis of cellular 5 mC with nucleotide and strand resolution, we recently developed an approach based on transcription‐activator‐like effector (TALE) proteins [11] serving as imaging receptors [12] . TALEs bind one strand of a DNA duplex via a modular domain of repeats, each recognizing one nucleobase via a repeat variable di‐residue (RVD, Figure 1b) [13] .…”

“…In this setup, we employ pairs consisting of a GFP‐TALE_2 with HD repeats, and a control mCherry‐TALE_2 with universal G* repeats opposite the CpGs at positions 5 and 10 (Figure 4b). In co‐stains of fixed cell samples with differential SATIII methylation, an increased methylation is thereby indicated by a reduction of the HD TALE_2 fluorescence, whereas the fluorescence of the C/5 mC‐promiscuous G* TALE_2 serving as control remains unaltered [12] . For generating cell samples with methylated and unmethylated SATIII, but minimal perturbation of the global methylation landscape, we employed our previous DNA‐methyltransferase construct “DNMT act ” consisting of DNMT3a3 L [22] fused to “TALE_0” targeting the SATIII sequence “(T)GATTCCATTCCATTCCATT” (differing from the target sequence of TALE_2 to avoid competition) [12] .…”

“…In co‐stains of fixed cell samples with differential SATIII methylation, an increased methylation is thereby indicated by a reduction of the HD TALE_2 fluorescence, whereas the fluorescence of the C/5 mC‐promiscuous G* TALE_2 serving as control remains unaltered [12] . For generating cell samples with methylated and unmethylated SATIII, but minimal perturbation of the global methylation landscape, we employed our previous DNA‐methyltransferase construct “DNMT act ” consisting of DNMT3a3 L [22] fused to “TALE_0” targeting the SATIII sequence “(T)GATTCCATTCCATTCCATT” (differing from the target sequence of TALE_2 to avoid competition) [12] . Expression of DNMT act in HEK 293T cells leads to an approximately sixfold increase in SATIII methylation compared to expression of a catalytically inactive E756A mutant [23] (“DNMT inact ”, Figure S4) [12] .…”

“…For generating cell samples with methylated and unmethylated SATIII, but minimal perturbation of the global methylation landscape, we employed our previous DNA‐methyltransferase construct “DNMT act ” consisting of DNMT3a3 L [22] fused to “TALE_0” targeting the SATIII sequence “(T)GATTCCATTCCATTCCATT” (differing from the target sequence of TALE_2 to avoid competition) [12] . Expression of DNMT act in HEK 293T cells leads to an approximately sixfold increase in SATIII methylation compared to expression of a catalytically inactive E756A mutant [23] (“DNMT inact ”, Figure S4) [12] . We sorted DNMT act or DNMT inact ‐transfected HEK 293T cells for identical DNMT expression levels and then re‐plated, fixed and co‐stained them with equimolar amounts of HD GFP‐TALE_2, and either NY* or NH* mCherry TALE_2 (see Figure S3 for microscopy).…”

Encoded, click-reactive DNA-binding domains for programmable capture of specific chromatin segments

“…2a). SATIII-TALE_wt targets the CpG-free SATIII sequence TGATTCCATTCCATTCCATT, 22 allowing DNA-binding without potential interference by CpG cytosine 5-methylation. 23 We initially conrmed selective binding of SATIII-TALE_wt to its target sequence in HEK293T cells by coimaging with HSF1 aer heat shock (Fig.…”