Design of Meningococcal Factor H Binding Protein Mutant Vaccines That Do Not Bind Human Complement Factor H

Pajón, Rolando; Beernink, Peter T.; Granoff, Dan M.

doi:10.1128/iai.00103-12

Cited by 24 publications

(26 citation statements)

References 60 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To identify residues that are necessary for high affinity fH interactions, we performed extensive Ala substitution mutagenesis to produce a catalogue of amino acids in each variant family that contribute to binding to fH, and could be modified in vaccine design. This adds to the three residues already described for V1 fHbp and for V2 fHbp which are required for high affinity binding, although the affinity of the modified V2 proteins for fH was not reported [23]. Our findings illustrate differences in the precise mechanisms by which fH engages fHbp from different families, even though the same face of fHbp is involved.…”

Section: Discussionsupporting

confidence: 46%

Design and Evaluation of Meningococcal Vaccines through Structure-Based Modification of Host and Pathogen Molecules

et al. 2012

View full text Add to dashboard Cite

Neisseria meningitis remains a leading cause of sepsis and meningitis, and vaccines are required to prevent infections by this important human pathogen. Factor H binding protein (fHbp) is a key antigen that elicits protective immunity against the meningococcus and recruits the host complement regulator, fH. As the high affinity interaction between fHbp and fH could impair immune responses, we sought to identify non-functional fHbps that could act as effective immunogens. This was achieved by alanine substitution of fHbps from all three variant groups (V1, V2 and V3 fHbp) of the protein; while some residues affected fH binding in each variant group, the distribution of key amino underlying the interaction with fH differed between the V1, V2 and V3 proteins. The atomic structure of V3 fHbp in complex with fH and of the C-terminal barrel of V2 fHbp provide explanations to the differences in the precise nature of their interactions with fH, and the instability of the V2 protein. To develop transgenic models to assess the efficacy of non-functional fHbps, we determined the structural basis of the low level of interaction between fHbp and murine fH; in addition to changes in amino acids in the fHbp binding site, murine fH has a distinct conformation compared with the human protein that would sterically inhibit binding to fHbp. Non-functional V1 fHbps were further characterised by binding and structural studies, and shown in non-transgenic and transgenic mice (expressing chimeric fH that binds fHbp and precisely regulates complement system) to retain their immunogenicity. Our findings provide a catalogue of non-functional fHbps from all variant groups that can be included in new generation meningococcal vaccines, and establish proof-in-principle for clinical studies to compare their efficacy with wild-type fHbps.

show abstract

Section: Discussionsupporting

confidence: 46%

Design and Evaluation of Meningococcal Vaccines through Structure-Based Modification of Host and Pathogen Molecules

et al. 2012

View full text Add to dashboard Cite

show abstract

“…The numbering of the positions of amino acid residues is based on the mature protein sequence beginning with the lipidated cysteine residue of fHbp ID 1 to facilitate comparison with our previous data [12, 16]. In our previous study of sub-family A mutants the most promising antigens appeared to be D211A and T221A/H223A 1 [16]. We subsequently found that the single amino acid substitution T221A gave an equivalent decrease in fH binding as the double mutant (data not shown).…”

Section: Methodsmentioning

confidence: 99%

“…Therefore the T221A and D211A mutant vaccines were investigated in the present study. Preparation of the D211A mutant was previously described [16]. The desired nucleotide substitutions for the T221A mutant were introduced into the pET21-fHbp ID 22 expression plasmid using the Phusion site-specific mutagenesis kit (Thermo Scientific) and the oligonucleotides: T221A_fwd, gcttaccacctcgcccttttcg; T221A_rev, gcctttttcttcgccgcc; (changes from the wild-type sequences underlined).…”

Section: Methodsmentioning

confidence: 99%

“…A broadly protective fHbp vaccine likely will require one fHbp antigen from sub-family B, and a second from sub-family A [5, 6]. However, amino acid substitutions that decrease fH binding in sub-family B do not necessarily decrease fH binding in sub-family A fHbp [16]. We recently described new mutations in fHbp from sub-family A that decreased fH binding [16].…”

Section: Introductionmentioning

confidence: 99%

“…However, amino acid substitutions that decrease fH binding in sub-family B do not necessarily decrease fH binding in sub-family A fHbp [16]. We recently described new mutations in fHbp from sub-family A that decreased fH binding [16]. Based on immunogenicity in wild-type mice, in which none of the fHbp vaccines bound to mouse fH, several of the fHbp mutants appeared to be promising vaccine candidates because they elicited similar serum bactericidal antibody responses to the control wild-type subfamily A fHbp vaccine.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Meningococcal factor H-binding protein vaccines with decreased binding to human complement factor H have enhanced immunogenicity in human factor H transgenic mice

Rossi¹,

Granoff²,

Beernink³

2013

Vaccine

Self Cite

View full text Add to dashboard Cite

Factor H-binding protein (fHbp) is a component of a meningococcal vaccine recently licensed in Europe for prevention of serogroup B disease, and a second vaccine in clinical development. The protein specifically binds human factor H (fH), which down-regulates complement activation and enhances resistance to bactericidal activity. There are conflicting data from studies in human fH transgenic mice on whether binding of human fH to fHbp vaccines decreases immunogenicity, and whether mutant fHbp vaccines with decreased fH binding have enhanced immunogenicity. fHbp can be classified into two sub-families based on sequence divergence and immunologic cross-reactivity. Previous studies of mutant fHbp vaccines with low fH binding were from sub-family B, which account for approximately 60% of serogroup B case isolates. In the present study, we evaluated the immunogenicity of two mutant sub-family A fHbp vaccines containing single substitutions, T221A or D211A, which resulted in 15- or 30-fold lower affinity for human fH, respectively, than the corresponding control wild-type fHbp vaccine. In transgenic mice with high serum concentrations of human fH, both mutant vaccines elicited significantly higher IgG titers and higher serum bactericidal antibody responses than the control fHbp vaccine that bound human fH. Thus, mutations introduced into a sub-family A fHbp antigen to decrease fH binding can increase protective antibody responses in human fH transgenic mice. Collectively the data suggest that mutant fHbp antigens with decreased fH binding will result in superior vaccines in humans.

show abstract

Meningococcal factor H binding protein as immune evasion factor and vaccine antigen

Principato

Pizza²,

Rappuoli³

2020

FEBS Letters

View full text Add to dashboard Cite

Factor H binding protein (fHbp) is a key virulence factor of Neisseria meningitidis and a main component of the two licensed vaccines against serogroup B meningococcus (Bexsero and Trumenba). fHbp is a surface‐exposed lipoprotein that enables the bacterium to survive in human blood by binding the human complement regulator factor H (fH). When used as vaccine, the protein induces antibodies with potent bactericidal activity. While the fHbp gene is present in the majority of N. meningitidis serogroup B isolates, the expression level varies up to 15 times between different strains and more than 700 different sequence variants have been described. Antigenically, the protein has been divided into three variants or two subfamilies. The 3D structure of fHbp alone, in combination with fH or in complex with bactericidal antibodies, has been key to understanding the molecular details of the protein. In this article, we will review the biochemical and immunological properties of fHbp, and its key role in meningococcal pathogenesis, complement regulation, and immune evasion.

show abstract

Design of Meningococcal Factor H Binding Protein Mutant Vaccines That Do Not Bind Human Complement Factor H

Cited by 24 publications

References 60 publications

Design and Evaluation of Meningococcal Vaccines through Structure-Based Modification of Host and Pathogen Molecules

Design and Evaluation of Meningococcal Vaccines through Structure-Based Modification of Host and Pathogen Molecules

Meningococcal factor H-binding protein vaccines with decreased binding to human complement factor H have enhanced immunogenicity in human factor H transgenic mice

Meningococcal factor H binding protein as immune evasion factor and vaccine antigen

Contact Info

Product

Resources

About