Design of a protocol for obtaining genomic DNA from saliva using mouthwash: Samples taken from patients with periodontal disease

Mendoza, Ángel Chávez; Buentello-Volante, Beatríz; Hernández, María Esther Ocharan; Mendoza, Claudia Camelia Calzada; Flores-Pliego, Arturo; Baptista-González, Héctor; Estrada-Juárez, Higinio

doi:10.1016/j.jobcr.2016.01.002

Cited by 6 publications

(5 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…We collected saliva samples from enrolled patients for DNA extraction ( Mendoza et al., 2016 ). Patients were instructed to vigorously rinse their mouths for 30 s with 20 mL mouthwash (Listerine Cool Mint; Johnson & Johnson; 21.6% alcohol), and the mouthwash was then collected in a 50-mL tube.…”

Section: Methodsmentioning

confidence: 99%

Genetic risk model for in-stent restenosis of second-and third-generation drug-eluting stents

et al. 2021

View full text Add to dashboard Cite

Summary The new generation, i.e., second- and third-generation, drug-eluting stents (DESs) remain a risk of in-stent restenosis (ISR). We evaluated the power of a genetic risk score (GRS) model to identify high-risk populations for new generation DES ISR. We enrolled patients with coronary artery disease (CAD) treated with new generations DESs by a single-center cohort study in Taiwan and evaluated their genetic profile. After propensity score matching, there were 343 patients and 153 patients in the derivation and validation cohorts, respectively. Five selected single-nucleotide polymorphisms (SNPs), i.e., SNPs in CAMLG , GALNT2 , C11orf84 , THOC5 , and S AMD11 , were included to calculate the GRS for new generation DES ISR. In the derivation and the validation cohorts, patients with a GRS greater than or equal to 3 had significantly higher new generation DES ISR rates. We provide biological information for interventional cardiologists prior to percutaneous coronary intervention by specific five SNP-derived GRS.

show abstract

Section: Methodsmentioning

confidence: 99%

Genetic risk model for in-stent restenosis of second-and third-generation drug-eluting stents

et al. 2021

View full text Add to dashboard Cite

show abstract

“…Buccal cells were obtained from Patient 1, both parents, and sister following informed consent. Genome extraction was completed on all samples using the protocol designed by (Mendoza et al, ). Primers for FOXP1 transcript 1 were designed: forward 5′‐AGATAGCCAGGAAGGCAGTG‐3′ and reverse 5′‐CATGTGGGAGGGAGAAACTC‐3′.…”

Section: Methodsmentioning

confidence: 99%

Identification of a de novo FOXP1 mutation and incidental discovery of inherited genetic variants contributing to a case of autism spectrum disorder and epilepsy

Jay

Mitra

Harding

et al. 2019

Molec Gen & Gen Med

View full text Add to dashboard Cite

Background Autism spectrum disorder is commonly co‐diagnosed intellectual disability, language disorder, anxiety, and epilepsy, however, symptom management is difficult due to the complex genetic nature of ASD. Methods We present a next‐generation sequencing‐based case study with both de novo and inherited genetic variants and highlight the impact of structural variants on post‐translational regulation of protein expression. Since management of symptoms has classically been through pharmaceutical therapies, a pharmacogenomics screen was also utilized to determine possible drug/gene interactions. Results A de novo variant was identified within the FOXP1 3′ untranslated regulatory region using exome sequencing. Additionally, inherited variants that likely contribute to the current and potential future traits were identified within the COMT, SLC6A4 , CYP2C19, and CYP2D6 genes. Conclusion This study aims to elucidate how a collection of variant genotypes could potentially impact neural development resulting in a unique phenotype including ASD and epilepsy. Each gene's contribution to neural development is assessed, and the interplay of these genotypes is discussed. The results highlight the utility of exome sequencing in conjunction with pharmacogenomics screening when evaluating possible causes of and therapeutic treatments for ASD‐related symptoms.

show abstract

“…Saliva samples were transported to the Molecular Genetics Lab of the Human Genetics Department, Medical Research Institute, Alexandria University. Saliva provided a great number of nucleated cells (e.g., epithelial cells, leukocytes, and Langerhans cells) . The QIAamp DNA Blood Mini Kit (QIAGEN, Hilden, Germany) vacuum procedure was used.…”

Section: Methodsmentioning

confidence: 99%

A Genetic Association Study of a Specific Gene and Severe Form of Resorption in the Edentulous Mandible in the Egyptian Population

Emam

Amin

Issa

et al. 2019

Journal of Prosthodontics

View full text Add to dashboard Cite

Purpose To investigate for the first time in Egypt and the Middle East the relationship between a specific gene and the presence of severely resorbed edentulous mandibular ridges in a sample of the Egyptian population. Materials and Methods The study was conducted on 50 subjects divided into case and control groups according to the residual ridge height. Saliva was used as a convenient source of DNA in the dental clinic. A certain genetic variation (1772C>T) in an important gene related to bone healing (hypoxia‐inducible factor‐1 alpha [HIF1‐α] gene) was selected. The genetic variation 1772C>T is a single nucleotide polymorphism (SNP) that occurs when corresponding sequences of DNA from different individuals differ at one base. Then, we have 2 forms of the gene (2 alleles): C and T. SNPs typically have 3 genotypes; in this study, they are the CC, CT, and TT genotypes. Polymerase chain reaction (PCR) restriction fragment length polymorphism (RFLP) was the method performed for genotyping. The statistical significance of the results was evaluated by the Chi‐square test and Fisher Exact test. Results A statistically significant difference in the distribution of the TT genotype between both groups was detected with p‐value = 0.049. There was also a difference in the distribution of the CC and CT genotypes, but it was not statistically significant, since the p‐values were 0.733 and 0.145, respectively. The T alleles were more abundant in the case group, while the control group showed more frequency of the C allele with no statistical significance. Conclusion The TT genotype of the 1772C>T polymorphism of HIF1‐α gene is related to the presence of severely atrophied residual ridges in completely edentulous Egyptians. This can be used as a marker to predict the future condition of the ridge using saliva samples. Further studies on larger scale are recommended.

show abstract

Design of a protocol for obtaining genomic DNA from saliva using mouthwash: Samples taken from patients with periodontal disease

Abstract: The present protocol represents an easy, safe and economical technique for obtaining high quality genomic DNA.

Cited by 6 publications

References 28 publications

Genetic risk model for in-stent restenosis of second-and third-generation drug-eluting stents

Genetic risk model for in-stent restenosis of second-and third-generation drug-eluting stents

Identification of a de novo FOXP1 mutation and incidental discovery of inherited genetic variants contributing to a case of autism spectrum disorder and epilepsy

A Genetic Association Study of a Specific Gene and Severe Form of Resorption in the Edentulous Mandible in the Egyptian Population

Contact Info

Product

Resources

About