Design of a Polymerase Chain Reaction for Specific Detection of Corn Stunt Spiroplasma

Abstract

Corn stunt disease is a major limiting factor in production of corn (Zea mays) in the Americas. To develop a polymerase chain reaction (PCR) assay specific for detection of the causal agent, Spiroplasma kunkelii, PCR primers were designed on the basis of unique regions of the nucleotide sequence of the S. kunkelii spiralin gene. DNA was amplified in PCRs containing template DNAs derived from laboratory strains of S. kunkelii and from naturally diseased corn plants collected in the field. No DNA amplification was observed in PCRs containing template DNAs derived from other Spiroplasma species tested or from healthy corn or corn infected by maize bushy stunt phytoplasma. The availability of a sensitive and specific PCR for detection and identification of S. kunkelii should facilitate studies of the ecology of this pathogen, as well as its influence in the incidence, spread, and severity of corn stunting diseases.

Incidência de viroses e enfezamentos e estimativa de perdas causadas por molicutes em milho no Paraná

“…Foram coletadas 441 amostras de folhas, em plantas apresentando deformações foliares, suspeitas de estarem infectadas pelo MRCV, mesmo sem a presença de enações sobre as nervuras, na face inferior das folhas, sintomas típicos desta virose. Estas plantas foram submetidas ao teste sorológico DAS-ELISA, com anti-soro específico para detecção do MRCV (Giménez Pecci et al, 1991).…”

“…Nas seis amostras com sintomas atípicos de MBSP, a detecção de fitoplasma foi testada também utilizando-se condições de reação e os oligonucleotídeos R16F2 5' ACGACTGCTGCTAAGACTGG 3'e R16R0 5' TGA CGGGCGGTGTGTACAAACCCCG 3', descritos por Lee et al (1993). A detecção de espiroplasma foi feita utilizando-se condições de reação e oligonucleotídeos CSSF2 5' GGCAAAAGATGTAACAAAAGT 3' e CSSR6 5' GTTTACTTCAACAGTAGTTGCG 3', segundo Barros et al (2001).…”

“…Na detecção de MRCV por DAS-ELISA, amostras de folhas foram maceradas em tampão PBS + 0,05% de Tween 20, seguindo-se o procedimento para o teste DAS-ELISA, conforme Giménez Pecci et al (1991), utilizando-se IgG anti-MRCV, produzida no INTA, Córdoba.…”

Cryptic plasmid pSKU146 from the wall-less plant pathogen Spiroplasma kunkelii encodes an adhesin and components of a type IV translocation-related conjugation system

“…Some phytoplasmas even share both insect vector and plant host species with a spiroplasma. For example, maize bushy stunt (MBS) phytoplasma shares plant and insect hosts with S. kunkelii, and periwinkle virescence phytoplasma (beet leafhopper transmitted virescence agent, VR) shares plant and insect hosts with S. citri (Barros et al, 2001;Nault, 1980;Oldfield, 1984). Moreover, since S. kunkelii is a member of the spiroplasma-Mycoplasma mycoides clade (Weisburg et al, 1989), which contains M. mycoides and Mycoplasma capricolum, one may ask whether similar plasmids play a role in the biology of mammalian pathogenic Mycoplasma spp., including the development and spread of antibiotic resistance.…”

Exitianus obscurinervis (Hemiptera: Cicadellidae), a New Experimental Vector of Spiroplasma kunkelii

“…CSS was detected by polymerase chain reaction (PCR) amplification of the CSS spiralin gene, following the method of Barros et al (2001). Previously extracted CSS DNA was included in each gel as a positive control.…”