Depleting Gene Activities in Early <i>Drosophila</i> Embryos with the “Maternal-Gal4–shRNA” System

Staller, Max V.; Dong, Yan; Randklev, Sakara; Bragdon, Meghan D. J.; Wunderlich, Zeba; Tao, Rong; Perkins, Lizabeth A.; DePace, Angela H.; Perrimon, Norbert

doi:10.1534/genetics.112.144915

Cited by 100 publications

(118 citation statements)

References 25 publications

Supporting

Mentioning

112

Contrasting

Order By: Relevance

“…med.harvard.edu. Briefly, we combined short hairpin RNA knockdown of bcd with in situ hybridization and two-photon imaging and automated image segmentation (38,(64)(65)(66). Hb protein stains used a guinea pig anti-Hb from John Reinitz, University of Chicago, Chicago, IL.…”

Section: Methodsmentioning

confidence: 99%

Shadow enhancers enable Hunchback bifunctionality in the Drosophila embryo

Staller

Vincent

Bragdon

et al. 2015

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

Hunchback (Hb) is a bifunctional transcription factor that activates and represses distinct enhancers. Here, we investigate the hypothesis that Hb can activate and repress the same enhancer. Computational models predicted that Hb bifunctionally regulates the even-skipped (eve) stripe 3+7 enhancer (eve3+7) in Drosophila blastoderm embryos. We measured and modeled eve expression at cellular resolution under multiple genetic perturbations and found that the eve3+7 enhancer could not explain endogenous eve stripe 7 behavior. Instead, we found that eve stripe 7 is controlled by two enhancers: the canonical eve3+7 and a sequence encompassing the minimal eve stripe 2 enhancer (eve2+7). Hb bifunctionally regulates eve stripe 7, but it executes these two activities on different pieces of regulatory DNA-it activates the eve2+7 enhancer and represses the eve3+7 enhancer. These two "shadow enhancers" use different regulatory logic to create the same pattern.enhancer | computational model | bifunctional transcription factor | Drosophila development | Hunchback T ranscription factors (TFs) are typically categorized as activators or repressors, but many TFs can act bifunctionally by both activating and repressing target genes (1-4). Changes in TF activity can result from posttranslational modifications, protein cleavage, or translocation of cofactors into the nucleus (5-7). However, in cases where a TF activates and represses genes in the same cells, bifunctionality is controlled by enhancer sequences, which are responsible for tissue-specific gene expression (8). For example, in Drosophila, Dorsal activates genes when it binds to enhancers alone or near Twist (9, 10) but represses genes when it binds near other TFs (11-13). The DNA sequence of a TF's binding site can also alter TF activity [e.g., the glucocorticoid receptor (14, 15)]. Identifying how the activity of bifunctional TFs is controlled will be critical for inferring accurate gene regulatory networks from genomic data (16).Here, we investigate how TF bifunctionality is controlled using a classic example: the Drosophila gene hunchback (hb) (1, 17, 18). Hb both activates and represses even-skipped (eve) by acting on multiple enhancers. Hb activates eve stripes 1 and 2 and represses stripes 4, 5, and 6 (19-22). Computational models from us and others support the hypothesis that Hb both activates and represses the enhancer that controls eve stripes 3 and 7 (eve3+7) (Fig. 1) (22-25).In contrast to others, our computational models of eve3+7 activity do not include regulatory DNA sequence (26-30). Instead, our modeling approach uses regression to identify the activators and repressors that control a given pattern; we refer to the identity and role of the regulators as "regulatory logic." Modeling regulatory logic without including DNA sequence enables a powerful strategy to dissect gene regulation in a complex locus. We can compare the regulatory logic of an enhancer reporter pattern to that of the corresponding portion of the endogenous pattern to determine whether the an...

show abstract

Section: Methodsmentioning

confidence: 99%

Shadow enhancers enable Hunchback bifunctionality in the Drosophila embryo

Staller

Vincent

Bragdon

et al. 2015

Proc. Natl. Acad. Sci. U.S.A.

View full text Add to dashboard Cite

show abstract

“…In particular, results from various large-scale screens have been included. Among these are germline and maternal effect screens using the MTD-Gal4 driver (Staller et al 2013;Sopko et al 2014;Yan et al 2014), a muscle screen using the muscle Dmef2-Gal4 line (Perrimon and Randkelv, unpublished results), a screen in gut stem cells using the esg-Gal4 (Zeng et al 2015), and a screen of maternally expressed genes involved in embryonic patterning (Liu and Lasko 2015). As of May 2015, and specific for the TRiP stocks, the RSVP contains 8334 data entries for 5202 TRiP stocks representing 3735 fly genes.…”

Section: Validation Of the Trip Linesmentioning

confidence: 99%

The Transgenic RNAi Project at Harvard Medical School: Resources and Validation

et al. 2015

Self Cite

View full text Add to dashboard Cite

To facilitate large-scale functional studies in Drosophila, the Drosophila Transgenic RNAi Project (TRiP) at Harvard Medical School (HMS) was established along with several goals: developing efficient vectors for RNAi that work in all tissues, generating a genome-scale collection of RNAi stocks with input from the community, distributing the lines as they are generated through existing stock centers, validating as many lines as possible using RT-qPCR and phenotypic analyses, and developing tools and web resources for identifying RNAi lines and retrieving existing information on their quality. With these goals in mind, here we describe in detail the various tools we developed and the status of the collection, which is currently composed of 11,491 lines and covering 71% of Drosophila genes. Data on the characterization of the lines either by RT-qPCR or phenotype is available on a dedicated website, the RNAi Stock Validation and Phenotypes Project (RSVP, http://www.flyrnai.org/RSVP.html), and stocks are available from three stock centers, the Bloomington Drosophila Stock Center (United States), National Institute of Genetics (Japan), and TsingHua Fly Center (China). KEYWORDS RNAi; Drosophila; screens; phenotypes; functional genomics A striking finding from the genomic revolution and wholegenome sequencing is the amount of information missing on gene function. Although Drosophila is arguably the bestunderstood multicellular organism and a proven model system for human diseases, mutations mapped to specific genes with readily detectable phenotypes have been isolated for 15% of the .13919 annotated fly coding genes (http:// flybase.org/; FlyBase R6.06). The lack of information on the majority of genes (the "phenotype gap") suggests that researchers have been unable to either assay their roles experimentally and/or resolve issues of functional redundancy. In addition, some phenotypes may be only detected on specific diets and environments. Further, our understanding of the function of many genes for which we have some information is limited by pleiotropy, whereby an earlier function of the gene prevents analysis of later functions.The availability of in vivo RNAi has revolutionized the ability of Drosophila researchers to disrupt the activity of single genes with spatial and temporal resolution (Dietzl et al. 2007; see review by Perrimon et al. 2010), and thus address the phenotype gap. Motivated by the power of the approach and the needs of the community, three large-scale efforts, the Vienna Drosophila RNAi Center (VDRC, http:// stockcenter.vdrc.at/control/main), the National Institute of Genetics (NIG, http://www.shigen.nig.ac.jp/fly/nigfly/index.jsp), and the Drosophila Transgenic RNAi Project (TRiP) at Harvard Medical School (HMS) (http://www.flyrnai.org/TRiP-HOME. html) have over the years generated large numbers of RNAi lines that aim to cover all Drosophila genes. These resources are proving invaluable to address a myriad of questions in various biological and biomedical fields including but not limite...

show abstract

“…heat-shocked during the second to third instar larval stage at 37°C for 1 h for 2 d. zld − embryos were depleted of maternal Zld through the "Maternal-Gal4-shRNA" system (Staller et al 2013), where MTD-Gal4/UAS-shRNA-zld females were crossed to wt males. The MTD-Gal4 stock (Petrella et al 2007), which drives robust Gal4 expression throughout oogenesis, as well as the passenger strand sequence CGGATGCAAGTTGCAGTGCAA targeting zld transcripts (shRNA-zld) were obtained from the Perrimon laboratory.…”

Section: Fly Strainsmentioning

confidence: 99%

Zelda overcomes the high intrinsic nucleosome barrier at enhancers during Drosophila zygotic genome activation

et al. 2015

View full text Add to dashboard Cite

The Drosophila genome activator Vielfaltig (Vfl), also known as Zelda (Zld), is thought to prime enhancers for activation by patterning transcription factors (TFs). Such priming is accompanied by increased chromatin accessibility, but the mechanisms by which this occurs are poorly understood. Here, we analyze the effect of Zld on genome-wide nucleosome occupancy and binding of the patterning TF Dorsal (Dl). Our results show that early enhancers are characterized by an intrinsically high nucleosome barrier. Zld tackles this nucleosome barrier through local depletion of nucleosomes with the effect being dependent on the number and position of Zld motifs. Without Zld, Dl binding decreases at enhancers and redistributes to open regions devoid of enhancer activity. We propose that Zld primes enhancers by lowering the high nucleosome barrier just enough to assist TFs in accessing their binding motifs and promoting spatially controlled enhancer activation if the right patterning TFs are present. We envision that genome activators in general will utilize this mechanism to activate the zygotic genome in a robust and precise manner.

show abstract

Depleting Gene Activities in Early Drosophila Embryos with the “Maternal-Gal4–shRNA” System

Cited by 100 publications

References 25 publications

Shadow enhancers enable Hunchback bifunctionality in the Drosophila embryo

Shadow enhancers enable Hunchback bifunctionality in the Drosophila embryo

The Transgenic RNAi Project at Harvard Medical School: Resources and Validation

Zelda overcomes the high intrinsic nucleosome barrier at enhancers during Drosophila zygotic genome activation

Contact Info

Product

Resources

About