Delivery of AP-2α siRNA into cultured bovine trophoblast cells by electroporation repressed key placenta-specific gene expression

Zhou, Xuan; Wang, Zhenyun; Zhang, Zhen; Cui, Qun-Wei; Wang, Yachun; Wang, Genlin

doi:10.1016/j.gene.2012.03.005

Cited by 3 publications

(2 citation statements)

References 42 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Nonsense RNAi (nsRNA) was used as a negative control (NC), qRT-PCR and western blot were used for evaluation the transfection efficiency. Two siRNAs were designed for KRT16 knockdown, siRNA1: GACCTGAGGAACAAGATCATT and siRNA2: AACAGCGAACTGGTACAGAGC, the siRNA for TFAP2A: GGGUAUUAACAUCCCAGUTT was adopted from a published article 15. The following Nonsense siRNA was used as negative control: UUCUCCGAACGUGUCACGUTT.…”

Section: Methodsmentioning

confidence: 99%

TFAP2A Induced KRT16 as an Oncogene in Lung Adenocarcinoma via EMT

et al. 2019

View full text Add to dashboard Cite

Objectives : keratin 16 (KRT16) is a type I cytokeratin that overexpressed in many kinds of cancers, but unlike other keratins, KRT16 was poorly studied, so the aim of current study was to determine the biological role of KRT16 in lung adenocarcinoma (LUAD). Materials and Methods : by utilizing open access data, we determined KRT16 expression in LUAD. After that we evaluated the biological role of KRT16 in-vitro and in-vivo . We also explored the reason for KRT16 overexpression. Last, we explored the clinical significance of KRT16 in LUAD. Results : we found KRT16 is overexpressed in LUAD and positively correlated with lymph node metastasis. Knockdown of KRT16 significantly influenced the LUAD cells' migration, invasion, proliferation and epithelial-mesenchymal transition (EMT). Moreover, TFAP2A could transcriptionally overexpress KRT16, which contributed to the TFAP2A tumorigenicity. Last, we determined that high level of KRT16 predicts poor prognosis of LUAD patients. Conclusions : our data indicate that, TFAP2A induced KRT16 overexpression promotes tumorigenicity in LUAD via EMT, and KRT16 expression could serve as an independent prognosis marker.

show abstract

Section: Methodsmentioning

confidence: 99%

TFAP2A Induced KRT16 as an Oncogene in Lung Adenocarcinoma via EMT

et al. 2019

View full text Add to dashboard Cite

show abstract

“…Trophoblast cells characteristically emerge in early gestation in the cow placenta. They secrete pivotal hormones and cytokines for fetal-maternal communication, including placental lactogens (CSH1), PRP1, and PAG1, which are necessary for pregnancy establishment in cows ( Zhou et al, 2012 ). In this study, the UNC and BNC clusters showed the strongest signaling output capacity among the 10 identified clusters (Supplementary Figure S12), indicating their importance in microenvironment homeostasis regulation.…”

Section: Discussionmentioning

confidence: 99%

Spatially resolved transcriptomic profiling of placental development in dairy cow

Tan,

Liu,

Dou

et al. 2024

Zoological Research

View full text Add to dashboard Cite

The placenta plays a crucial role in successful mammalian reproduction. Ruminant animals possess a semi-invasive placenta characterized by a highly vascularized structure formed by maternal endometrial caruncles and fetal placental cotyledons, essential for full-term fetal development. The cow placenta harbors at least two trophoblast cell populations: uninucleate (UNC) and binucleate (BNC) cells. However, the limited capacity to elucidate the transcriptomic dynamics of the placental natural environment has resulted in a poor understanding of both the molecular and cellular interactions between trophoblast cells and niches, and the molecular mechanisms governing trophoblast differentiation and functionalization. To fill this knowledge gap, we employed Stereo-seq to map spatial gene expression patterns at near single-cell resolution in the cow placenta at 90 and 130 days of gestation, attaining high-resolution, spatially resolved gene expression profiles. Based on clustering and cell marker gene expression analyses, key transcription factors, including YBX1 and NPAS2, were shown to regulate the heterogeneity of trophoblast cell subpopulations. Cell communication and trajectory analysis provided a framework for understanding cell-cell interactions and the differentiation of trophoblasts into BNCs in the placental microenvironment. Differential analysis of cell trajectories identified a set of genes involved in regulation of trophoblast differentiation. Additionally, spatial modules and co-variant genes that help shape specific tissue structures were identified. Together, these findings provide foundational insights into important biological pathways critical to the placental development and function in cows.

show abstract

Macroscopic inhibition of DNA damage repair pathways by targeting AP-2α with LEI110 eradicates hepatocellular carcinoma

Wang,

Zhao,

Zhao

et al. 2024

Commun Biol

View full text Add to dashboard Cite

DNA damage repair (DDR) genes are known to be closely associated with the progression of Hepatocellular carcinoma (HCC). Here we report a unique cluster of “deletion-up” genes in HCC, which are accordantly overexpressed in HCC patients and predict the unfavorable prognosis. Binding motif analysis and further validation with ChIP-qPCR unveil that the AP-2α directly modulate the transcription of critical DNA repair genes including TOP2A, NUDT1, POLD1, and PARP1, which facilitates the sanitation of oxidized DNA lesions. Structural analysis and the following validation identify LEI110 as a potent AP-2α inhibitor. Together, we demonstrate that LEI110 stabilizes AP-2α and sensitizes HCC cells toward DNA-damaging reagents. Altogether, we identify AP-2α as a crucial transcription modulator in HCC and propose small-molecule inhibitors targeting AP-2α are a promising novel class of anticancer agents. Our study provides insights into the concept of macroscopic inhibition of DNA damage repair-related genes in cancer treatment.

show abstract

Delivery of AP-2α siRNA into cultured bovine trophoblast cells by electroporation repressed key placenta-specific gene expression

Cited by 3 publications

References 42 publications

TFAP2A Induced KRT16 as an Oncogene in Lung Adenocarcinoma via EMT

TFAP2A Induced KRT16 as an Oncogene in Lung Adenocarcinoma via EMT

Spatially resolved transcriptomic profiling of placental development in dairy cow

Macroscopic inhibition of DNA damage repair pathways by targeting AP-2α with LEI110 eradicates hepatocellular carcinoma

Contact Info

Product

Resources

About