Delineation of a New Species of the
 Borrelia burgdorferi
 Sensu Lato Complex,
 Borrelia americana
 sp. nov

Rudenko, Nataliia; Golovchenko, Maryna; Lin, Tao; Gao, Lihui; Grubhoffer, Libor; Oliver, James H.

doi:10.1128/jcm.01050-09

Cited by 109 publications

(95 citation statements)

References 65 publications

(28 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In far-western North America, I. spinipalpis serves as a maintenance vector of B. burgdorferi s.l., and I. pacificus acts as a bridge vector to humans [7]. Likewise, in southeastern U.S.A., I. affinis and I. minor act as maintenance vectors in the enzootic cycle of B. burgdorferi s.l, and I. scapularis serves as a bridge vector to humans [36].…”

Section: Dispersal Of B Americana-infected Ticks In North Americamentioning

confidence: 99%

“…In southeastern United States, B. americana has been isolated from I. minor immatures collected from ground-frequenting songbirds [7] and, in California, from I. pacificus adults [25]. Since Ixodes affinis Neumann, I. minor, and I. scapularis infest rodents and birds in southeastern United States, there is every likelihood that north-bound passerine migrants are trans-porting B. americana-infected ticks to central and eastern Canada.…”

Section: Dispersal Of B Americana-infected Ticks In North Americamentioning

confidence: 99%

See 1 more Smart Citation

Detection of Borrelia americana in the Avian Coastal Tick, Ixodes auritulus (Acari: Ixodidae), Collected from a Bird Captured in Canada

Scott¹,

Foley²

2016

OJAS

View full text Add to dashboard Cite

We document the first record of Borrelia americana in Canada. This Borrelia was detected in an avian coast tick, Ixodes auritulus (Acari: Ixodidae), collected from a Varied Thrush, Ixoreus naevius, along coastal British Columbia. Using real-time PCR and DNA sequencing of the flagellin gene, we determined that the borrelial amplicon from the I. auritulus nymph was 99% homologous with B. americana type strain SCW-41. Because patients infected with B. americana can be seronegative for Lyme disease, medical professionals should be willing to pursue molecular analyses and consider treatment for patients with Lyme disease-like symptoms.

show abstract

Section: Dispersal Of B Americana-infected Ticks In North Americamentioning

confidence: 99%

Section: Dispersal Of B Americana-infected Ticks In North Americamentioning

confidence: 99%

Detection of Borrelia americana in the Avian Coastal Tick, Ixodes auritulus (Acari: Ixodidae), Collected from a Bird Captured in Canada

Scott¹,

Foley²

2016

OJAS

View full text Add to dashboard Cite

show abstract

“…Total DNA was extracted using a NucleoSpin Tissue Kit (Macherey-Nagel, Germany) according to the manufacturer's protocol. Detection of spirochetes was performed by amplification of a 154 bp fragment of flagellin gene using primers FlaF1 (AAGCAAATTTAGGTGCTTTCCAA) and FlaR1 (GCA ATCATTGCCATTGCAGA) [12]. At the 3 rd week after infection the presence of spirochetes was confirmed in all ear biopsy samples regardless of the ospC type of strain used for infection.…”

Section: Methodsmentioning

confidence: 99%

Invasive potential of Borrelia burgdorferi sensu stricto ospC type L strains increases the possible disease risk to humans in the regions of their distribution

Golovchenko

Šíma

Hajdusek

et al. 2014

Parasites & Vectors

Self Cite

View full text Add to dashboard Cite

Background: Analysis of Borrelia burgdorferi ospC types from the southeastern U.S.A. supported the common belief that various ospC types are geographically restricted and host specific. Being widely distributed in the region, the southeastern population of B. burgdorferi is represented by a surprisingly small number of ospC types. Types B, G and H are dominant or common and are invasive, while scarce type L, restricted mostly to the southeastern U.S.A., is believed to rarely if ever cause human Lyme disease. OspC type B and L strains are represented in the region at the same rate, however their distribution among tick vectors and vertebrate hosts is unequal. Findings: Direct diagnostics was used to analyze the ability of B. burgdorferi ospC type L strains to disseminate into host tissues. Mice were infected by subcutaneous injections of B. burgdorferi strains of various ospC types with different invasive capability. Spirochete levels were examined in ear, heart, bladder and joint tissues. Noninfected I. ricinus larvae were fed on infected mice until repletion. Infection rates were determined in molted nymphs. Infected nymphs were then fed on naïve mice, and spirochete transmission from infected nymphs to mice was confirmed. Conclusions: B. burgdorferi ospC type L strains from the southeastern U.S.A. have comparable potential to disseminate into host tissues as ospC types strains commonly associated with human Lyme disease in endemic European and North American regions. We found no difference in the invasive ability of ospC type B and L strains originated either from tick vectors or vertebrate hosts.

show abstract

“…

(3,(10)(11)(12)(13)(14). To date, whole-genome sequences of B. burgdorferi from China have not been reported.

…”

mentioning

confidence: 99%

Genome Sequence of Borrelia garinii Strain NMJW1, Isolated from China

et al. 2012

View full text Add to dashboard Cite

(3,(10)(11)(12)(13)(14). To date, whole-genome sequences of B. burgdorferi from China have not been reported. Here, we report the complete linear chromosome of Borrelia garinii strain NMJW1, isolated from Ixodes persulcatus in the Inner Mongolia Autonomous Region in northeastern China. B. garinii NMJW1, grown in Barbour-Stoenner-Kelly H medium (Sigma, St. Louis, MO) supplemented with 6% rabbit serum at 30°C (2, 15), was sequenced with a combined strategy involving the Roche 454 GS FLX sequencer and Solexa. Using strain B. garinii PBi as a reference, an average 157.52-fold genomic coverage was obtained over 383,310 reads, which were assembled using the Newbler 2.6 assembler (Roche), generating 36 interscaffold and intrascaffold gaps. We resequenced by Solexa sequencing technology to close these gaps and then used SOAPdenovo, version 1.05 (7), to assemble the 9,906,046 pair-end Illumina sequencing reads (3-kb and 500-bp inserts) with 1,097.27-fold genome coverage which were generated by using the Illumina HiSeq2000 system (9). Based on this assembly, the interscaffold and intrascaffold gaps were closed by local assembly. Gene prediction was performed using Glimmer1 (4). The tRNA genes were searched for with tRNAScan-SE2 (8). The rRNA genes were searched for with RNAmmer3 (6). Protein BLAST4 was run, using the translated coding sequences as a query against the reference sequence (1).The linear B. garinii NMJW1 chromosome includes 902,789 bp in total (28.4% GC content) and carries 33 tRNAs, 4 complete rRNAs, and 813 open reading frames (ORFs), of which 75% do not code for a hypothetical protein. This strain is highly similar to the B. garinii Bgvir strain (isolated from Russian) and the B. garinii PBi strain (isolated from Germany). The core-gene analysis between B. garinii NMJW1 and B. garinii Bgvir (832 genes) (5) showed that 796 ORFs are conserved, and strain NMJW1 was 97.91% similar to strain Bgvir. In-depth comparative analysis among different species will be the focus of our work.Comparative analysis of B. garinii NMJW1 with the different Borrelia species and in-depth study of strain NMJW1 can provide major insights into the evolution of Borrelia and explain its taxonomic relationships in China, and new knowledge will be gained from analyzing the genome which will help identify new surface proteins to possibly help prevent, diagnose, and treat Lyme disease.Nucleotide sequence accession number. The complete genome sequence of B. garinii NMJW1 was deposited in GenBank under the accession number CP003866. ACKNOWLEDGMENTS

show abstract

Delineation of a New Species of the Borrelia burgdorferi Sensu Lato Complex, Borrelia americana sp. nov

Abstract: Analysis of borrelia isolates collected from ticks, birds, and rodents from the southeastern United

Cited by 109 publications

References 65 publications

Detection of <i>Borrelia americana</i> in the Avian Coastal Tick, <i>Ixodes auritulus</i> (Acari: Ixodidae), Collected from a Bird Captured in Canada

Detection of <i>Borrelia americana</i> in the Avian Coastal Tick, <i>Ixodes auritulus</i> (Acari: Ixodidae), Collected from a Bird Captured in Canada

Invasive potential of Borrelia burgdorferi sensu stricto ospC type L strains increases the possible disease risk to humans in the regions of their distribution

Genome Sequence of Borrelia garinii Strain NMJW1, Isolated from China

Contact Info

Product

Resources

About

Delineation of a New Species of the Borrelia burgdorferi Sensu Lato Complex, Borrelia americana sp. nov

Abstract: Analysis of borrelia isolates collected from ticks, birds, and rodents from the southeastern United

Cited by 109 publications

References 65 publications

Detection of &lt;i&gt;Borrelia americana&lt;/i&gt; in the Avian Coastal Tick, &lt;i&gt;Ixodes auritulus&lt;/i&gt; (Acari: Ixodidae), Collected from a Bird Captured in Canada

Detection of &lt;i&gt;Borrelia americana&lt;/i&gt; in the Avian Coastal Tick, &lt;i&gt;Ixodes auritulus&lt;/i&gt; (Acari: Ixodidae), Collected from a Bird Captured in Canada

Invasive potential of Borrelia burgdorferi sensu stricto ospC type L strains increases the possible disease risk to humans in the regions of their distribution

Genome Sequence of Borrelia garinii Strain NMJW1, Isolated from China

Contact Info

Product

Resources

About

Detection of <i>Borrelia americana</i> in the Avian Coastal Tick, <i>Ixodes auritulus</i> (Acari: Ixodidae), Collected from a Bird Captured in Canada

Detection of <i>Borrelia americana</i> in the Avian Coastal Tick, <i>Ixodes auritulus</i> (Acari: Ixodidae), Collected from a Bird Captured in Canada