Deletion of <i>Osr2</i> Partially Rescues Tooth Development in <i>Runx2</i> Mutant Mice

Kwon, Hyuk Jae; Park, E.K.; Jia, Shihai; Liu, H.; Lan, Yu; Jiang, Rulang

doi:10.1177/0022034515583673

Cited by 7 publications

(6 citation statements)

References 37 publications

(58 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…As a potent CDK inhibitor, p21 can be induced by activation of TGF-β signaling and leads to cell cycle arrest and antiproliferation (Murray 2004;Zhang et al 2017). In the developing tooth, p21 has been shown to be a critical regulator involved in enamel knot formation (Jernvall et al 1998;Kwon et al 2015). In our study, the increased level of p21 expression apparently did not affect tooth patterning, as evidenced by the unaffected number of tooth cusp, cusp shape, and normal tooth morphogenesis.…”

Section: Discussionsupporting

confidence: 38%

Smad7 Regulates Dental Epithelial Proliferation during Tooth Development

et al. 2019

View full text Add to dashboard Cite

Tooth morphogenesis involves dynamic changes in shape and size as it proceeds through the bud, cap, and bell stages. This process requires exact regulation of cell proliferation and differentiation. Smad7, a general antagonist against transforming growth factor–β (TGF-β) signaling, is necessary for maintaining homeostasis and proper functionality in many organs. While TGF-β signaling is widely involved in tooth morphogenesis, the precise role of Smad7 in tooth development remains unknown. In this study, we showed that Smad7 is expressed in the developing mouse molars with a high level in the dental epithelium but a moderate to weak level in the dental mesenchyme. Smad7 deficiency led to a profound decrease in tooth size primarily due to a severely compromised cell proliferation capability in the dental epithelium. Consistent with the tooth shrinkage phenotype, RNA sequencing (RNA-seq) analysis revealed that Smad7 ablation downregulated genes referred to epithelial cell proliferation and cell cycle G1/S phase transition, whereas the upregulated genes were involved in responding to TGF-β signaling and cell cycle arrest. Among these genes, the expression of Cdkn1a (encoding p21), a negative cell proliferation regulator, was remarkably elevated in parallel with the diminution of Ccnd1 encoding the crucial cell cycle regulator cyclin D1 in the dental epithelium. Meanwhile, the expression level of p-Smad2/3 was ectopically elevated in the developing tooth germ of Smad7 null mice, indicating the hyperactivation of the canonical TGF-β signaling. These effects were reversed by addition of TGF-β signaling inhibitor in cell cultures of Smad7−/− molar tooth germs, with rescued expression of cyclin D1 and cell proliferation rate. In sum, our studies demonstrate that Smad7 functions primarily as a positive regulator of cell proliferation via inhibition of the canonical TGF-β signaling during dental epithelium development and highlight a crucial role for Smad7 in regulating tooth size.

show abstract

Section: Discussionsupporting

confidence: 38%

Smad7 Regulates Dental Epithelial Proliferation during Tooth Development

et al. 2019

View full text Add to dashboard Cite

show abstract

“…It has been shown that BMP4 cannot induce Fgf3 in dental mesenchyme and vice versa (Bei and Maas 1998), suggesting that Shh-FGF and Shh-BMP are relatively independent regulation loops. Runx2 is a common upstream regulator of Bmp4 and Fgf3 (Aberg et al 2004;Kwon et al 2015). Moreover, it also positively regulates the Shh expression in epithelium via mesenchymal Fgf3 and other unknown signal molecules (Aberg et al 2004).…”

Section: Discussionmentioning

confidence: 99%

Mesenchymal Sufu Regulates Development of Mandibular Molars via Shh Signaling

Cui

et al. 2019

J Dent Res

View full text Add to dashboard Cite

Sonic hedgehog ( Shh) in dental epithelium regulates tooth morphogenesis by epithelial-mesenchymal signaling transduction. However, the action of Shh signaling regulation in this process is not well understood. Here we find that mesenchymal Suppressor of Fused ( Sufu), a major negative regulator of Shh signaling, plays an important role in modulating the tooth germ morphogenesis during the bud-to-cap stage transition. Deletion of Sufu in dental mesenchyme by Dermo1-Cre mice leads to delayed development of mandibular molar into cap stage with defect of primary enamel knot (EK) formation. We show the disruption of cell proliferation and programmed cell death in dental epithelium and mesenchyme in Sufu mutants. Epithelial-specific adhesion molecule E-cadherin is evidently reduced in the bilateral basal cells of tooth germ at E14.5. The cells in the presumptive EK, predominantly expressing P-cadherin, appear stratified but fail to condense. Moreover, the transcripts of primary EK marker genes, including Shh, Fgf4, and p21, are significantly decreased compared to controls. In contrast, we find that deficiency of Sufu results in elevation of Shh signaling in mesenchyme, indicated by the significant upregulation of Gli1 and Ptch1. Meanwhile, the expression of Bmp4 and Fgf3, the critical factors of mesenchymal-epithelial induction, is significantly inhibited in dental mesenchyme. Furthermore, the expression of Runx2 experiences a transient decrease at the bud stage. Taken together, these data suggest that mesenchymal Sufu is necessary for tuning the Shh signaling, which may act as an upstream modulator of Bmp4 and Fgf3 to coordinate the interplay between the dental mesenchyme and epithelium of tooth germ.

show abstract

“…For in situ hybridization, the heads from E14.5 and E16.5 mouse embryos and postnatal Day 0 (P0) mice were fixed in 4% paraformaldehyde (PFA) in a phosphate‐buffered solution (PBS), dehydrated with ethanol, and embedded in paraffin. Sections (5 μm thickness) were hybridized with DIG‐labeled Bbx complementary RNA probes, as previously described (Kwon et al, 2015). For probe cloning and synthesis, Bbx complementary DNA was amplified with a forward primer containing the Eco R1 sequence, 5′‐CGAATTCCCCCAGTAGAAAGGACCACA‐3′, and a reverse primer containing the Xho I sequence, 5′‐CCTCGAGGCACCTTTGCAAGACCTCTC‐3′, using Pfx Taq polymerase (Invitrogen, Carlsbad, CA), and cloned into pBluescript SK+.…”

Section: Methodsmentioning

confidence: 99%

“…Sections (5 μm thickness) were hybridized with DIG-labeled Bbx complementary RNA probes, as previously described (Kwon et al, 2015).…”

Section: X-gal Staining and In Situ Hybridizationmentioning

confidence: 99%

Bobby sox homolog regulates tooth root formation through modulation of dentin sialophosphoprotein

Ihn

Kim

Lim

et al. 2020

Journal Cellular Physiology

View full text Add to dashboard Cite

Tooth root development occurs through the interaction of multiple growth factors and transcription factors expressed in Hertwig's epithelial root sheath (HERS) and dental mesenchyme. Previously, we demonstrated that bobby sox homolog (Bbx) regulates odontoblast differentiation of human dental pulp stem cells. Here, we generated Bbx knockout (Bbx −/−) mice to address the functional role of Bbx in tooth formation. During tooth development, Bbx was expressed in both dental epithelium

show abstract

Deletion of Osr2 Partially Rescues Tooth Development in Runx2 Mutant Mice

Cited by 7 publications

References 37 publications

Smad7 Regulates Dental Epithelial Proliferation during Tooth Development

Smad7 Regulates Dental Epithelial Proliferation during Tooth Development

Mesenchymal Sufu Regulates Development of Mandibular Molars via Shh Signaling

Bobby sox homolog regulates tooth root formation through modulation of dentin sialophosphoprotein

Contact Info

Product

Resources

About