Delayed Mammary Tumor Progression in Muc-1 Null Mice

Spicer, Andrew P.; Rowse, Gerald J.; Lidner, Thomas K.; Gendler, Sandra J.

doi:10.1074/jbc.270.50.30093

Cited by 231 publications

(82 citation statements)

References 71 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Interestingly, MUC1 is also expressed in immune cells including B cells, T cells, monocytes, macrophages and dendritic cells [17-20]. However, MUC1 activities have been primarily characterized in tumor cells where high expression levels in tumors correlate with a poor prognosis for the patient due to its ability to promote cell growth and survival [21-23]. In fact, the National Cancer Institute has priority-ranked MUC1 at #2 on a list of cancer vaccine target antigens where major criteria were immunogenicity, oncogenicity and therapeutic function [24].…”

Section: Introductionmentioning

confidence: 99%

Novel roles for mucin 1 in the kidney

Al‐bataineh

Sutton²,

Hughey

2017

Current Opinion in Nephrology and Hypertension

View full text Add to dashboard Cite

Purpose of the review Recent studies in the kidney have revealed that the well-characterized tumor antigen mucin 1 (MUC1/Muc1) also has numerous functions in the normal and injured kidney. Recent findings Mucin 1 is a transmembrane mucin with a robust glycan-dependent apical targeting signal and efficient recycling from endosomes. It was recently reported that the TRPV5 calcium channel is stabilized on the cell surface by galectin-dependent cross-linking to mucin 1, providing a novel mechanism for regulation of ion channels and normal electrolyte balance. Our recent studies in mice show that mucin 1 is induced after ischemia, stabilizing HIF-1α and β-catenin levels, and transactivating the HIF-1 and β-catenin protective pathways. However, prolonged induction of either pathway in the injured kidney can proceed from apparent full recovery to chronic kidney disease. A very recent report indicates that aberrant activation of mucin1 signaling after ischemic injury in mice and humans is associated with development of chronic kidney disease and fibrosis. A frame-shift mutation in MUC1 was recently identified as the genetic lesion causing Medullary Cystic Kidney Disease type 1, now appropriately renamed MUC1 Kidney Disease (MKD). Summary Studies of mucin 1 in the kidney now reveal significant functions for the extracellular mucin-like domain and signaling through the cytoplasmic tail.

show abstract

Section: Introductionmentioning

confidence: 99%

Novel roles for mucin 1 in the kidney

Al‐bataineh

Sutton²,

Hughey

2017

Current Opinion in Nephrology and Hypertension

View full text Add to dashboard Cite

show abstract

“…Overexpression of MUC1 is associated with invasive and metastatic tumors of the colon, pancreas, gall bladder, and oral epithelium [4]. Mammary tumors of MUC1 knockout mice grow slower and have a reduced ability to metastasize [107]. In the early steps of pancreatic carcinogenesis, changes in DNA methylation and histone acetylation lead to the upregulation of MUC4 [108,109].…”

Section: Contribution Of Mucins To Carcinogenesis and Metastasismentioning

confidence: 99%

Transmembrane Mucins: Signaling Receptors at the Intersection of Inflammation and Cancer

Putten¹,

Strijbis²

2017

J Innate Immun

206

213

View full text Add to dashboard Cite

Mucosal surfaces line our body cavities and provide the interaction surface between commensal and pathogenic microbiota and the host. The barrier function of the mucosal layer is largely maintained by gel-forming mucin proteins that are secreted by goblet cells. In addition, mucosal epithelial cells express cell-bound mucins that have both barrier and signaling functions. The family of transmembrane mucins consists of diverse members that share a few characteristics. The highly glycosylated extracellular mucin domains inhibit invasion by pathogenic bacteria and can form a tight mesh structure that protects cells in harmful conditions. The intracellular tails of transmembrane mucins can be phosphorylated and connect to signaling pathways that regulate inflammation, cell-cell interactions, differentiation, and apoptosis. Transmembrane mucins play important roles in preventing infection at mucosal surfaces, but are also renowned for their contributions to the development, progression, and metastasis of adenocarcinomas. In general, transmembrane mucins seem to have evolved to monitor and repair damaged epithelia, but these functions can be highjacked by cancer cells to yield a survival advantage. This review presents an overview of the current knowledge of the functions of transmembrane mucins in inflammatory processes and carcinogenesis in order to better understand the diverse functions of these multifunctional proteins.

show abstract

“…Tumor development in MMTV‐PyMT(PyMT) mice follows a progression path including hyperplasia, adenoma, early carcinoma and late carcinoma, which is very similar to progressions seen in human breast cancers 17. PyMT mice in the C57BL/6 background develop palpable breast tumors around 90 days of age 15, which is slower than mice in the FvB background 14.…”

Section: Resultsmentioning

confidence: 92%

“…Female Kit +/W‐sh and male PyMT/Kit +/W‐sh mice were mated against each other to generate female littermates that are PyMT/wild‐type (WT) and PyMT/Kit W‐sh/W‐sh . Mice were genotyped for the PyMT allele by polymerase chain reaction (PCR) using the following primers: forward primer, AGTCACTGCTACTGCACCCAG‐and reverse primer, CTCTCCTCAGTTCTTCGCTCC as described 15. Sash mutant mice were genotyped based on the coat color that shows mice with black fur with white sash at the midline (The Jackson Laboratory).…”

Section: Methodsmentioning

confidence: 99%

Mammary tumor growth and metastasis are reduced in c‐Kit mutant Sash mice

Zhu

Chen

et al. 2016

Cancer Medicine

View full text Add to dashboard Cite

Besides its well‐known function in allergic response, mast cell, one of the key immune cells present in tumor microenvironment, plays important roles in cancer progression. However, the functional role of mast cells in breast cancer development and metastasis is not well understood. To test the involvement of mast cells in breast cancer, we examined the effects of loss of mast cells on mammary tumor development by crossing the well‐known mast cell deficient mouse strain sash (KitW‐sh/W‐sh) with the mammary tumor transgenic mouse strain MMTV‐Polyoma Middle T antigen (PyMT). Although mammary tumor onset was not affected in the absence of mast cells, mammary growth and metastasis were reduced in PyMT/KitW‐sh/W‐sh mice compared with PyMT/wild‐type mice (WT). Histological and immunofluorescent analyses showed that tumors from PyMT/KitW‐sh/W‐sh mice showed largely differentiated morphology with reduced angiogenesis compared with MMTV‐PyMT/WT mice. Our results suggest that mast cells may promote breast cancer growth and metastasis. Agents that can block mast cells growth are potential new therapies to treat metastatic breast cancer.

show abstract

Delayed Mammary Tumor Progression in Muc-1 Null Mice

Cited by 231 publications

References 71 publications

Novel roles for mucin 1 in the kidney

Novel roles for mucin 1 in the kidney

Transmembrane Mucins: Signaling Receptors at the Intersection of Inflammation and Cancer

Mammary tumor growth and metastasis are reduced in c‐Kit mutant Sash mice

Contact Info

Product

Resources

About