Degradation of Cyclin A Does Not Require Its Phosphorylation by CDC2 and Cyclin-dependent Kinase 2

Abstract

Many cyclins are degraded by the ubiquitination/proteasome pathways involving the anaphase-promoting complex and SCF complexes. These degradations are frequently dependent on phosphorylation by cyclin-dependent kinases (CDKs), providing a self-limiting mechanism for CDK activity. Here we present evidence from in vitro and in vivo assay systems that the degradation of human cyclin A can be inhibited by kinase-inactive mutants of CDK2 and CDC2. One obvious interpretation of these results is that like other cyclins, CDK-dependent phosphorylation of the cyclin A may be involved in cyclin A degradation. Our data indicated that CDK2 can phosphorylate cyclin A on Ser-154. Site-directed mutagenesis of Ser-154 abolished the phosphorylation by recombinant CDK2 in vitro and the majority of cyclin A phosphorylation in the cell. Activation of CDK2 and binding to SKP2 or p27 KIP1 were not affected by the phosphorylation of Ser-154. Surprising, in marked contrast to cyclin E, where phosphorylation of Thr-380 by CDK2 is required for proteolysis, degradation of cyclin A was not affected by Ser-154 phosphorylation. It is likely that the stabilization of cyclin A by the kinaseinactive CDKs was mainly due to a cell cycle effect. These data suggest an important difference between the regulation of cyclin A and cyclin E. Cyclins and cyclin-dependent kinases (CDKs)1 are key regulators of the eukaryotic cell cycle. Cyclin B is associated with CDC2 and the cyclin B-CDC2 complexes regulate entry into M phase (1). Cyclin A-CDK2 and cyclin E-CDK2 complexes are important for progression through S phase and the G 1 /S transition, respectively (2, 3). D-type cyclins are associated with CDK4 and CDK6, and the complexes are required for G 1 progression (2).The kinase activity of CDK is tightly regulated by an intricate system of phosphorylation and protein-protein interactions (4, 5). By definition, the activation of CDKs is dependent on the association with a cyclin subunit. The post-translational regulation of cyclins occurs mainly through degradation (6). The mitotic cyclins are degraded near the end of anaphase by the ubiquitin-proteasome system, consisting of a nonspecific ubiquitin-activating enzyme, a ubiquitin-carrier protein, a cyclin-specific ubiquitin ligase known as the cyclosome or anaphase-promoting complex (APC), and a constitutively active proteasome complex. The N-terminal destruction box sequences of the mitotic cyclins are required for their degradation (7), possibly because they are recognized by the cyclin-specific ubiquitin ligase enzyme. Recent biochemical and genetic studies have demonstrated that vertebrate APC contains at least eight subunits (APC1-APC8) (8).The activity of APC is highly regulated, turning on in anaphase and persist until late G 1 (9, 10). Association between APC and the WD40 repeat-containing protein Hct1p (also known as Cdh1p) is required for the degradation of mitotic cyclins in yeast (11). From S phase onward, phosphorylation of Hct1p by CDKs blocked the Hct1p-APC interaction (12), allowing the mi...

Determinants of Mitotic Catastrophe on Abrogation of the G2 DNA Damage Checkpoint by UCN-01

“…Monoclonal antibodies against b-actin (26), CDK1 (27), cyclin A2 (28), cyclin B1 (22), FLAG (29), a-tubulin (30), and polyclonal antibodies against FLAG (21) were obtained from sources as described previously.…”

“…No authentication was done by the authors. The HeLa cell line used in this study was a clone that expressed the Tet repressor (21). To generate anaphasepromoting complex/cyclosome (APC/C) reporter cells, HeLa cells expressing histone H2B-GFP (green fluorescent protein; ref.…”

The N-terminal Regulatory Domain of Cyclin A Contains Redundant Ubiquitination Targeting Sequences and Acceptor Sites

“…FLAG-cyclin A, 34 S154A, 34 and R70A+R71A in pUHD-P1, 35 cyclin A in pET21d, 34 cyclin B-H6 in pET21d, 34 HA-Ub in pUHD-P2, 17 H6-Ub in pET8b, 34 and histone H2B-GFP construct 36 were constructed or obtained from sources as previously described. The cyclin A cDNA was amplified by PCR with the cyclin A reverse primer 34 and the primer: 5'GGGGCCATGGCGCAGCAGCAGAG-GCC3' (N∆61), 5'ACGACCATGGTTGCACCCCTTAAGGA3' (N∆71), 5'TGCCATGGAAAAAGAAGCTCAGAAGA3' (N∆106), 5'GCCCATG-GATGCCCTGGCTTTTAATTC3' (N∆123), 5'TACCATGGACATGT-CAATTGTATT3' (N∆157); the PCR products were cut with Nco I-EcoR I, and ligated into pUHD-P1 to create the respective FLAG-tagged constructs for mammalian expression. Bovine cyclin A(N∆171) in pET21d was from Tim Hunt (Cancer Research UK, South Mimms, UK) and was amplified by PCR with T7 primer and cyclin A reverse, cut with Nco I-EcoR I, and put into pUHD-P1.…”

“…Bovine cyclin A(N∆171) in pET21d was from Tim Hunt (Cancer Research UK, South Mimms, UK) and was amplified by PCR with T7 primer and cyclin A reverse, cut with Nco I-EcoR I, and put into pUHD-P1. The cyclin A fragment from GST-cyclin A(C∆70) 34 was transferred into the Nco I site of pUHD-P1 to create FLAG-cyclin A(C∆71). GST-cyclin A in pGEX-KG 34 was amplified by PCR with a vector forward primer and 5'GGCTCCATGGTGTTTGCTTTCCAAG3'; the PCR product was cut with Nco I and put into cyclin B(N∆88)-H6 in pET21d 35 to create cyclin A(C∆93)-cyclin B(N∆88)-H6 in pET21d.…”

“…The cyclin A fragment from GST-cyclin A(C∆70) 34 was transferred into the Nco I site of pUHD-P1 to create FLAG-cyclin A(C∆71). GST-cyclin A in pGEX-KG 34 was amplified by PCR with a vector forward primer and 5'GGCTCCATGGTGTTTGCTTTCCAAG3'; the PCR product was cut with Nco I and put into cyclin B(N∆88)-H6 in pET21d 35 to create cyclin A(C∆93)-cyclin B(N∆88)-H6 in pET21d. The Nco I fragment was also put into FLAG-cycA(N∆157) in pUHD-P1 to create FLAG-cyclin A(∆94-157) in pUHD-P1, and into FLAG-cyclin A(N∆123) in pUHD-P1 to create FLAG-cyclin A(∆94-123) in pUHD-P1.…”