Defense responses of harvested tomato fruit to burdock fructooligosaccharide, a novel potential elicitor

Wang, Fengde; Feng, Guihua; Chen, Kaoshan

doi:10.1016/j.postharvbio.2008.09.002

Cited by 56 publications

(28 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Tomato fruits were treated with distilled water (CK) and trans-2-hexenal (T) at 20°C. Vertical bars represent standard deviations of the means expression changes in response to stress (Parrou et al 1999;Rep et al 1999;Wang et al 2009). The transient changes in gene expression may help the cell to rapidly adjust the concentrations of the corresponding gene products to the levels required for growth at the new conditions.…”

Section: Discussionmentioning

confidence: 99%

Postharvest treatment with trans-2-hexenal induced resistance against Botrytis cinerea in tomato fruit

Guo

Feng²,

Zhang

et al. 2014

Australasian Plant Pathol.

Self Cite

View full text Add to dashboard Cite

Trans-2-hexenal is a biocidal molecule released in many fruits and vegetables. In this paper, the effects of trans-2-hexenal on the control of postharvest diseases in tomato fruits were investigated. We indicated that the incidence of natural infection and infection by Botrytis cinerea in tomato fruits was significantly decreased after treatment with trans-2-hexenal. Trans-2-hexenal increased the mRNA levels of genes encoding ethylene receptors, lipoxygenase and phenylalanine ammonia lyase (PAL), but did not induce the mRNA accumulation of the pathogenesis-related proteins, such as PR-1a or PR-5. The activities of peroxidases and PAL and the accumulation of phenolic compounds were significantly enhanced after trans-2-hexenal treatment. This is the first report of trans-2-hexenal as an elicitor and its ability to control the postharvest diseases in tomato fruits. These results suggest that the controlling effects of trans-2-hexenal on both natural infection and gray mould in tomato fruits might be related to JA/ETmediated induced systemic resistance.

show abstract

Section: Discussionmentioning

confidence: 99%

Postharvest treatment with trans-2-hexenal induced resistance against Botrytis cinerea in tomato fruit

Guo

Feng²,

Zhang

et al. 2014

Australasian Plant Pathol.

Self Cite

View full text Add to dashboard Cite

show abstract

“…Foliar application of harpin protein was found to reduce bacterial spots in tomatoes [57]. Chitosan oligosaccharide and Burdock fructooligosaccharide (BFO) were used as elicitors to inhibit natural postharvest diseases and reduce the incidence of disease resulting from inoculation with Botrytis cinerea in tomato fruits [58].…”

Section: The Use Of Elicitorsmentioning

confidence: 99%

“…For example, oxalic acid and calcium chloride enhanced defense-related enzyme activities, -1, 3-glucanase, PAL, POD and PPO, and reduced disease incidence caused by Alternaria alternata in pears [97]; Burdock fluctooligosaccharide and oligandrin inhibited postharvest disease caused by B. cinerea in tomatoes and activated PAL, enhancing the biosynthesis of phenolic compounds [58,115]; phosphite and acibenzolar-S-methyl induced the synthesis of trans-resveratrol in apples [50], and finally, potassium silicate increased the amounts of catechin and epicatechin in avocados [116].…”

Section: Other Elicitorsmentioning

confidence: 99%

Elicitors: A Tool for Improving Fruit Phenolic Content

2013

View full text Add to dashboard Cite

Fruits are one of the most important sources of polyphenols for humans, whether they are consumed fresh or as processed products. To improve the phenolic content of fruits, a novel field of interest is based on results obtained using elicitors, agrochemicals which were primarily designed to improve resistance to plant pathogens. Although elicitors do not kill pathogens, they trigger plant defense mechanisms, one of which is to increase the levels of phenolic compounds. Therefore, their application not only allows us to control plant disease but also to increase the phenolic content of plant foodstuffs. Pre-or post-harvest application of the most commonly used elicitors to several fruits is discussed in this review.

show abstract

“…The sequences used for ATP synthase CF1 α subunit ( atpA ) gene (GenBank accession number: AC_000188.1) amplification (reverse primer and forward primer) were GAGTGAGGCTTATTTGGGTC and AGGCTCATATACGGAACGG. The primer sequences used for β-actin amplification were those published by Wang [19]. The primer sequences used for atpA and Lexyl2 were found on the NCBI site. …”

Section: Methodsmentioning

confidence: 99%

Analysis of Clonostachys rosea-Induced Resistance to Tomato Gray Mold Disease in Tomato Leaves

et al. 2014

View full text Add to dashboard Cite

Tomato gray mold disease, caused by Botrytis cinerea, is a serious disease in tomato. Clonostachys rosea is an antagonistic microorganism to B. cinerea. To investigate the induced resistance mechanism of C. rosea, we examined the effects of these microorganisms on tomato leaves, along with changes in the activities of three defense enzymes (PAL, PPO, GST), second messengers (NO, H2O2, O2 −) and phytohormones (IAA, ABA, GA3, ZT, MeJA, SA and C2H4). Compared to the control, all treatments induced higher levels of PAL, PPO and GST activity in tomato leaves and increased NO, SA and GA3 levels. The expression of WRKY and MAPK, two important transcription factors in plant disease resistance, was upregulated in C. rosea- and C. rosea plus B. cinerea-treated samples. Two-dimensional gel electrophoresis analysis showed that two abundant proteins were present in the C. rosea plus B. cinerea-treated samples but not in the other samples. These proteins were determined (by mass spectrum analysis) to be LEXYL2 (β-xylosidase) and ATP synthase CF1 alpha subunit. Therefore, C. rosea plus B. cinerea treatment induces gray mold resistance in tomato. This study provides a basis for elucidating the mechanism of C. rosea as a biocontrol agent.

show abstract

Defense responses of harvested tomato fruit to burdock fructooligosaccharide, a novel potential elicitor

Cited by 56 publications

References 29 publications

Postharvest treatment with trans-2-hexenal induced resistance against Botrytis cinerea in tomato fruit

Postharvest treatment with trans-2-hexenal induced resistance against Botrytis cinerea in tomato fruit

Elicitors: A Tool for Improving Fruit Phenolic Content

Analysis of Clonostachys rosea-Induced Resistance to Tomato Gray Mold Disease in Tomato Leaves

Contact Info

Product

Resources

About